Incidental Mutation 'R8011:Hes3'
ID628790
Institutional Source Beutler Lab
Gene Symbol Hes3
Ensembl Gene ENSMUSG00000028946
Gene Namehes family bHLH transcription factor 3
SynonymsbHLHb43
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R8011 (G1)
Quality Score189.009
Status Validated
Chromosome4
Chromosomal Location152285972-152291662 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 152287481 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055754] [ENSMUST00000094438] [ENSMUST00000105650] [ENSMUST00000105651] [ENSMUST00000218045]
Predicted Effect probably benign
Transcript: ENSMUST00000055754
SMART Domains Protein: ENSMUSP00000052742
Gene: ENSMUSG00000042804

DomainStartEndE-ValueType
Pfam:7tm_1 24 298 1.2e-14 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094438
SMART Domains Protein: ENSMUSP00000092006
Gene: ENSMUSG00000028946

DomainStartEndE-ValueType
HLH 1 55 3.83e-11 SMART
low complexity region 129 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105650
SMART Domains Protein: ENSMUSP00000101275
Gene: ENSMUSG00000042804

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.4e-18 PFAM
low complexity region 478 495 N/A INTRINSIC
low complexity region 582 594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105651
SMART Domains Protein: ENSMUSP00000101276
Gene: ENSMUSG00000042804

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.3e-17 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218045
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and display no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Hes3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01834:Hes3 APN 4 152287100 missense probably damaging 0.97
IGL02426:Hes3 APN 4 152286940 missense probably benign 0.01
R4498:Hes3 UTSW 4 152287085 missense probably benign 0.00
R4696:Hes3 UTSW 4 152287667 missense probably damaging 1.00
R4784:Hes3 UTSW 4 152287832 missense probably damaging 1.00
R5042:Hes3 UTSW 4 152287043 missense possibly damaging 0.90
R6874:Hes3 UTSW 4 152287238 missense possibly damaging 0.65
R6993:Hes3 UTSW 4 152286923 missense probably benign
R7157:Hes3 UTSW 4 152288124 start gained probably benign
R8223:Hes3 UTSW 4 152287115 missense probably damaging 1.00
R8738:Hes3 UTSW 4 152287675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGAACAGAGGTCGCCTG -3'
(R):5'- AAGTACATGAGAAGCCTCCAG -3'

Sequencing Primer
(F):5'- ACTGGGTACTGGCCAGAGTC -3'
(R):5'- TCCAGAACTCACTGCAAGGTAGTG -3'
Posted On2020-06-25