Incidental Mutation 'R8011:Mok'
ID628792
Institutional Source Beutler Lab
Gene Symbol Mok
Ensembl Gene ENSMUSG00000056458
Gene NameMOK protein kinase
SynonymsStk30, MAPK/MAK/MRK/ overlapping kinase, MOK, Rage
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110807798-110840939 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 110814917 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070565] [ENSMUST00000084974] [ENSMUST00000177224]
Predicted Effect probably benign
Transcript: ENSMUST00000070565
SMART Domains Protein: ENSMUSP00000068904
Gene: ENSMUSG00000056458

DomainStartEndE-ValueType
S_TKc 4 285 6.78e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084974
SMART Domains Protein: ENSMUSP00000082041
Gene: ENSMUSG00000056458

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 138 8.4e-20 PFAM
Pfam:Pkinase 1 168 4.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177224
SMART Domains Protein: ENSMUSP00000135791
Gene: ENSMUSG00000056458

DomainStartEndE-ValueType
Pfam:Pkinase 4 70 2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the MAP kinase superfamily. The gene was found to be regulated by caudal type transcription factor 2 (Cdx2) protein. The encoded protein, which is localized to epithelial cells in the intestinal crypt, may play a role in growth arrest and differentiation of cells of upper crypt and lower villus regions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Mok
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Mok APN 12 110808197 unclassified probably benign
IGL01925:Mok APN 12 110808212 missense probably benign 0.15
IGL02660:Mok APN 12 110828065 missense probably damaging 0.99
R0256:Mok UTSW 12 110808105 missense probably damaging 1.00
R1797:Mok UTSW 12 110808045 missense probably benign 0.28
R2022:Mok UTSW 12 110811823 missense probably benign 0.00
R2175:Mok UTSW 12 110815200 missense probably benign 0.01
R3840:Mok UTSW 12 110815157 missense probably benign 0.04
R3841:Mok UTSW 12 110815157 missense probably benign 0.04
R4645:Mok UTSW 12 110808439 unclassified probably benign
R5711:Mok UTSW 12 110808069 missense probably damaging 1.00
R6084:Mok UTSW 12 110814946 missense probably benign 0.01
R6336:Mok UTSW 12 110834124 critical splice donor site probably null
R6544:Mok UTSW 12 110810755 missense probably damaging 1.00
R7403:Mok UTSW 12 110815129 critical splice donor site probably null
R7557:Mok UTSW 12 110808399 missense probably benign
R7789:Mok UTSW 12 110811827 missense probably damaging 1.00
R8169:Mok UTSW 12 110808365 missense probably benign 0.00
R8487:Mok UTSW 12 110809907 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGTGAGTCACAGTTATCCG -3'
(R):5'- ACCACATGCACAGGTATGG -3'

Sequencing Primer
(F):5'- ATATTGCTCTGGCCAAGGAC -3'
(R):5'- TGCACAGGTATGGGGCGG -3'
Posted On2020-06-25