Incidental Mutation 'R8017:Or4c1'
ID 628798
Institutional Source Beutler Lab
Gene Symbol Or4c1
Ensembl Gene ENSMUSG00000075093
Gene Name olfactory receptor family 4 subfamily C member 1
Synonyms MOR235-2, GA_x6K02T2Q125-50748233-50747292, Olfr1231
MMRRC Submission 067457-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R8017 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89132993-89133934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89133595 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 114 (I114F)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
AlphaFold Q7TQZ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000099786
AA Change: I114F

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: I114F

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216144
AA Change: I114F

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,744,469 (GRCm39) A51E unknown Het
A2ml1 C T 6: 128,558,410 (GRCm39) probably null Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Bnc2 A G 4: 84,329,662 (GRCm39) L118P Het
Ccdc18 T A 5: 108,376,511 (GRCm39) Y1317* probably null Het
Ccdc93 C T 1: 121,375,993 (GRCm39) T168M probably damaging Het
Cd109 G T 9: 78,614,828 (GRCm39) D1292Y possibly damaging Het
Cdh24 G T 14: 54,876,089 (GRCm39) N184K probably damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cspg4b T A 13: 113,456,157 (GRCm39) S734R Het
Efemp2 T A 19: 5,527,708 (GRCm39) C181* probably null Het
Eftud2 A G 11: 102,734,174 (GRCm39) probably null Het
Elp2 G A 18: 24,739,920 (GRCm39) V49M possibly damaging Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Exph5 G A 9: 53,284,752 (GRCm39) C611Y probably benign Het
Gm9376 T G 14: 118,504,951 (GRCm39) Y128D probably damaging Het
Gsdmc2 T A 15: 63,698,762 (GRCm39) N278I probably benign Het
Hace1 C T 10: 45,514,478 (GRCm39) T199M probably damaging Het
Hivep1 T C 13: 42,321,098 (GRCm39) V44A Het
Homez A C 14: 55,095,689 (GRCm39) D6E probably benign Het
Ighv5-12 A T 12: 113,665,792 (GRCm39) M102K probably damaging Het
Jup T C 11: 100,265,023 (GRCm39) T643A probably benign Het
Krt4 T A 15: 101,828,722 (GRCm39) I381F probably damaging Het
Krt6a A G 15: 101,602,304 (GRCm39) V127A probably damaging Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Mtfr2 A T 10: 20,229,900 (GRCm39) N153Y probably damaging Het
Npas3 G A 12: 54,091,462 (GRCm39) V339I probably damaging Het
Nsun2 C T 13: 69,775,764 (GRCm39) R438C probably damaging Het
Oga A T 19: 45,762,107 (GRCm39) W249R probably damaging Het
Or4k47 A C 2: 111,452,412 (GRCm39) D2E probably benign Het
Or5w16 T A 2: 87,577,392 (GRCm39) M284K probably damaging Het
Pdzd2 T C 15: 12,373,122 (GRCm39) R2338G probably damaging Het
Pgm1 A G 4: 99,843,875 (GRCm39) M553V probably benign Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Ppp2r5e A G 12: 75,511,703 (GRCm39) I340T probably damaging Het
Qprt C A 7: 126,707,996 (GRCm39) R145L probably damaging Het
Sertad4 T C 1: 192,528,829 (GRCm39) D329G probably benign Het
Setd2 C T 9: 110,431,255 (GRCm39) T583M Het
Slc12a7 T C 13: 73,947,839 (GRCm39) I652T probably damaging Het
Slc27a5 T C 7: 12,723,329 (GRCm39) D539G probably damaging Het
Slc36a2 A G 11: 55,055,095 (GRCm39) I320T probably benign Het
Slc6a20a A G 9: 123,466,917 (GRCm39) Y524H probably damaging Het
Slc6a20a T A 9: 123,493,639 (GRCm39) S81C probably damaging Het
St6gal1 G A 16: 23,176,585 (GRCm39) A393T probably benign Het
Stag3 T C 5: 138,299,465 (GRCm39) M828T possibly damaging Het
Stk36 T C 1: 74,651,925 (GRCm39) V406A probably benign Het
Svep1 G T 4: 58,146,637 (GRCm39) P335Q probably damaging Het
Svs5 T A 2: 164,175,341 (GRCm39) S64R possibly damaging Het
Taf2 A G 15: 54,928,013 (GRCm39) V130A possibly damaging Het
Tbrg4 C T 11: 6,568,517 (GRCm39) V421M probably damaging Het
Tbx4 G T 11: 85,804,986 (GRCm39) K358N probably damaging Het
Tenm4 A T 7: 96,353,248 (GRCm39) T384S probably damaging Het
Tubg1 G T 11: 101,014,854 (GRCm39) A199S probably benign Het
Zfp574 T A 7: 24,780,095 (GRCm39) C372* probably null Het
Other mutations in Or4c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Or4c1 APN 2 89,133,816 (GRCm39) missense possibly damaging 0.90
IGL02189:Or4c1 APN 2 89,133,641 (GRCm39) missense probably damaging 1.00
IGL02354:Or4c1 APN 2 89,133,526 (GRCm39) missense probably benign 0.03
IGL02361:Or4c1 APN 2 89,133,526 (GRCm39) missense probably benign 0.03
PIT4305001:Or4c1 UTSW 2 89,133,727 (GRCm39) missense probably benign 0.05
R0973:Or4c1 UTSW 2 89,133,528 (GRCm39) missense probably damaging 1.00
R0973:Or4c1 UTSW 2 89,133,528 (GRCm39) missense probably damaging 1.00
R0974:Or4c1 UTSW 2 89,133,528 (GRCm39) missense probably damaging 1.00
R2006:Or4c1 UTSW 2 89,133,160 (GRCm39) missense possibly damaging 0.60
R3150:Or4c1 UTSW 2 89,133,562 (GRCm39) missense possibly damaging 0.82
R3177:Or4c1 UTSW 2 89,133,562 (GRCm39) missense possibly damaging 0.82
R3277:Or4c1 UTSW 2 89,133,562 (GRCm39) missense possibly damaging 0.82
R3409:Or4c1 UTSW 2 89,133,717 (GRCm39) missense probably benign
R4208:Or4c1 UTSW 2 89,133,270 (GRCm39) missense probably damaging 1.00
R4412:Or4c1 UTSW 2 89,133,684 (GRCm39) missense probably benign 0.00
R4693:Or4c1 UTSW 2 89,133,621 (GRCm39) missense probably benign 0.07
R4697:Or4c1 UTSW 2 89,133,247 (GRCm39) missense probably damaging 1.00
R4697:Or4c1 UTSW 2 89,133,246 (GRCm39) missense possibly damaging 0.90
R5411:Or4c1 UTSW 2 89,133,920 (GRCm39) missense probably benign
R5992:Or4c1 UTSW 2 89,133,703 (GRCm39) missense possibly damaging 0.50
R6894:Or4c1 UTSW 2 89,133,837 (GRCm39) missense probably damaging 1.00
R8019:Or4c1 UTSW 2 89,133,595 (GRCm39) missense possibly damaging 0.94
R9274:Or4c1 UTSW 2 89,133,513 (GRCm39) missense probably damaging 0.98
R9457:Or4c1 UTSW 2 89,133,075 (GRCm39) missense probably damaging 1.00
X0064:Or4c1 UTSW 2 89,133,246 (GRCm39) missense possibly damaging 0.72
X0067:Or4c1 UTSW 2 89,133,498 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCAATGACATTGGGGCCAC -3'
(R):5'- GTTGGCTAATCTGCTCATTGTC -3'

Sequencing Primer
(F):5'- GCCACAGAAGGGCAGATTAATC -3'
(R):5'- GGCTAATCTGCTCATTGTCCTCAC -3'
Posted On 2020-06-30