Incidental Mutation 'R0717:Ccdc125'
ID62881
Institutional Source Beutler Lab
Gene Symbol Ccdc125
Ensembl Gene ENSMUSG00000048924
Gene Namecoiled-coil domain containing 125
Synonyms5830436D01Rik
MMRRC Submission 038899-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0717 (G1)
Quality Score157
Status Not validated
Chromosome13
Chromosomal Location100669717-100697240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100690358 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 241 (D241V)
Ref Sequence ENSEMBL: ENSMUSP00000058484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057325] [ENSMUST00000170347]
Predicted Effect probably damaging
Transcript: ENSMUST00000057325
AA Change: D241V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058484
Gene: ENSMUSG00000048924
AA Change: D241V

DomainStartEndE-ValueType
coiled coil region 101 193 N/A INTRINSIC
coiled coil region 286 308 N/A INTRINSIC
Blast:ETS 362 447 1e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000170347
AA Change: D215V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130107
Gene: ENSMUSG00000048924
AA Change: D215V

DomainStartEndE-ValueType
coiled coil region 101 151 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
Anxa11 G A 14: 25,874,789 probably null Het
Arhgap33 G T 7: 30,528,349 A475E probably damaging Het
Cacna1s A G 1: 136,098,291 N811S probably damaging Het
Cadm1 T A 9: 47,810,068 M252K probably benign Het
Cars T C 7: 143,584,755 R149G probably damaging Het
Col12a1 G A 9: 79,612,419 P2836S probably damaging Het
Grid2 T A 6: 64,666,275 I1007K possibly damaging Het
Hdhd2 G A 18: 76,951,204 A28T possibly damaging Het
Hivep1 A T 13: 42,154,946 T221S possibly damaging Het
Lztr1 A G 16: 17,516,048 probably null Het
Mbd1 C T 18: 74,273,597 A137V possibly damaging Het
Myh15 T C 16: 49,142,993 V1099A probably benign Het
Nox4 C A 7: 87,304,890 Y134* probably null Het
Olfr177 A G 16: 58,872,770 C127R probably damaging Het
Pde1c T A 6: 56,123,012 N681I probably damaging Het
Pon1 A G 6: 5,193,674 probably null Het
Prokr2 T C 2: 132,381,334 D96G probably damaging Het
Sdk2 C A 11: 113,832,326 V1280F probably damaging Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Tcaf1 A T 6: 42,678,665 M459K probably benign Het
Tmem201 T A 4: 149,718,810 N534Y probably damaging Het
Tspan9 A T 6: 127,966,380 probably null Het
Uba7 A T 9: 107,977,217 T252S probably benign Het
Ube2e2 T C 14: 18,888,435 T3A probably benign Het
Other mutations in Ccdc125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Ccdc125 APN 13 100687102 splice site probably benign
IGL02867:Ccdc125 APN 13 100684282 splice site probably benign
R0002:Ccdc125 UTSW 13 100693606 nonsense probably null
R0014:Ccdc125 UTSW 13 100684338 missense possibly damaging 0.82
R1661:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R1665:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R3118:Ccdc125 UTSW 13 100690319 missense possibly damaging 0.46
R3751:Ccdc125 UTSW 13 100677951 missense possibly damaging 0.90
R4415:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R4838:Ccdc125 UTSW 13 100677945 missense possibly damaging 0.52
R5734:Ccdc125 UTSW 13 100687114 missense possibly damaging 0.66
R5812:Ccdc125 UTSW 13 100684304 missense probably damaging 1.00
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6419:Ccdc125 UTSW 13 100690326 missense probably damaging 1.00
R6456:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R6733:Ccdc125 UTSW 13 100694487 missense probably benign 0.04
R7183:Ccdc125 UTSW 13 100690358 missense possibly damaging 0.90
R7354:Ccdc125 UTSW 13 100677874 intron probably null
R7644:Ccdc125 UTSW 13 100678376 intron probably null
R7910:Ccdc125 UTSW 13 100682819 missense possibly damaging 0.83
R7948:Ccdc125 UTSW 13 100696402 missense probably benign 0.00
R7973:Ccdc125 UTSW 13 100669823 start gained probably benign
X0027:Ccdc125 UTSW 13 100681845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGATGGAGACCAATCTTTGGGT -3'
(R):5'- TGTCCCTCAGGCATGGTCGAAA -3'

Sequencing Primer
(F):5'- GAGACCAATCTTTGGGTAATGTC -3'
(R):5'- GCAATGCTGTTGGGCTCC -3'
Posted On2013-07-30