Incidental Mutation 'R8017:Eftud2'
ID628826
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Nameelongation factor Tu GTP binding domain containing 2
Synonyms116kDa, Snrp116, U5-116kD
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8017 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102838473-102880985 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 102843348 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000107060] [ENSMUST00000173679] [ENSMUST00000173679]
Predicted Effect probably null
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132543
SMART Domains Protein: ENSMUSP00000133732
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFG_IV 1 65 2.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172611
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173679
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173679
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,850,676 A51E unknown Het
A2ml1 C T 6: 128,581,447 probably null Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
BC067074 T A 13: 113,319,623 S734R Het
Bnc2 A G 4: 84,411,425 L118P Het
Ccdc18 T A 5: 108,228,645 Y1317* probably null Het
Ccdc93 C T 1: 121,448,264 T168M probably damaging Het
Cd109 G T 9: 78,707,546 D1292Y possibly damaging Het
Cdh24 G T 14: 54,638,632 N184K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Efemp2 T A 19: 5,477,680 C181* probably null Het
Elp2 G A 18: 24,606,863 V49M possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Exph5 G A 9: 53,373,452 C611Y probably benign Het
Gm9376 T G 14: 118,267,539 Y128D probably damaging Het
Gsdmc2 T A 15: 63,826,913 N278I probably benign Het
Hace1 C T 10: 45,638,382 T199M probably damaging Het
Hivep1 T C 13: 42,167,622 V44A Het
Homez A C 14: 54,858,232 D6E probably benign Het
Ighv5-12 A T 12: 113,702,172 M102K probably damaging Het
Jup T C 11: 100,374,197 T643A probably benign Het
Krt4 T A 15: 101,920,287 I381F probably damaging Het
Krt6a A G 15: 101,693,869 V127A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mgea5 A T 19: 45,773,668 W249R probably damaging Het
Mtfr2 A T 10: 20,354,154 N153Y probably damaging Het
Npas3 G A 12: 54,044,679 V339I probably damaging Het
Nsun2 C T 13: 69,627,645 R438C probably damaging Het
Olfr1140 T A 2: 87,747,048 M284K probably damaging Het
Olfr1231 T A 2: 89,303,251 I114F possibly damaging Het
Olfr1297 A C 2: 111,622,067 D2E probably benign Het
Pdzd2 T C 15: 12,373,036 R2338G probably damaging Het
Pgm2 A G 4: 99,986,678 M553V probably benign Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Ppp2r5e A G 12: 75,464,929 I340T probably damaging Het
Qprt C A 7: 127,108,824 R145L probably damaging Het
Sertad4 T C 1: 192,846,521 D329G probably benign Het
Setd2 C T 9: 110,602,187 T583M Het
Slc12a7 T C 13: 73,799,720 I652T probably damaging Het
Slc27a5 T C 7: 12,989,402 D539G probably damaging Het
Slc36a2 A G 11: 55,164,269 I320T probably benign Het
Slc6a20a A G 9: 123,637,852 Y524H probably damaging Het
Slc6a20a T A 9: 123,664,574 S81C probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stag3 T C 5: 138,301,203 M828T possibly damaging Het
Stk36 T C 1: 74,612,766 V406A probably benign Het
Svep1 G T 4: 58,146,637 P335Q probably damaging Het
Svs5 T A 2: 164,333,421 S64R possibly damaging Het
Taf2 A G 15: 55,064,617 V130A possibly damaging Het
Tbrg4 C T 11: 6,618,517 V421M probably damaging Het
Tbx4 G T 11: 85,914,160 K358N probably damaging Het
Tenm4 A T 7: 96,704,041 T384S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Zfp574 T A 7: 25,080,670 C372* probably null Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102849184 missense probably benign
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1438:Eftud2 UTSW 11 102860042 missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102841463 splice site probably null
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7604:Eftud2 UTSW 11 102848012 missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102840108 missense probably damaging 1.00
R8019:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8139:Eftud2 UTSW 11 102867859 missense probably benign 0.04
R8431:Eftud2 UTSW 11 102846236 missense probably benign 0.08
R8545:Eftud2 UTSW 11 102840271 missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102868621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATGTGTGTACAGGCTG -3'
(R):5'- ACAGGGATGCATCAGAATTCC -3'

Sequencing Primer
(F):5'- GATGTGGGGTATCTTCCTTCCCATAC -3'
(R):5'- GGATGCATCAGAATTCCCTCAGTAG -3'
Posted On2020-06-30