Mutagenetix > Incidental Mutation

Incidental Mutation 'R8017:Pdzd2'

628838

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R8017 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12373036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 2338 (R2338G)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075317
AA Change: R2338G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: R2338G

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110065P20Rik	G	T	4: 124,850,676	A51E	unknown	Het
A2ml1	C	T	6: 128,581,447		probably null	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
BC067074	T	A	13: 113,319,623	S734R		Het
Bnc2	A	G	4: 84,411,425	L118P		Het
Ccdc18	T	A	5: 108,228,645	Y1317*	probably null	Het
Ccdc93	C	T	1: 121,448,264	T168M	probably damaging	Het
Cd109	G	T	9: 78,707,546	D1292Y	possibly damaging	Het
Cdh24	G	T	14: 54,638,632	N184K	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Efemp2	T	A	19: 5,477,680	C181*	probably null	Het
Eftud2	A	G	11: 102,843,348		probably null	Het
Elp2	G	A	18: 24,606,863	V49M	possibly damaging	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Exph5	G	A	9: 53,373,452	C611Y	probably benign	Het
Gm9376	T	G	14: 118,267,539	Y128D	probably damaging	Het
Gsdmc2	T	A	15: 63,826,913	N278I	probably benign	Het
Hace1	C	T	10: 45,638,382	T199M	probably damaging	Het
Hivep1	T	C	13: 42,167,622	V44A		Het
Homez	A	C	14: 54,858,232	D6E	probably benign	Het
Ighv5-12	A	T	12: 113,702,172	M102K	probably damaging	Het
Jup	T	C	11: 100,374,197	T643A	probably benign	Het
Krt4	T	A	15: 101,920,287	I381F	probably damaging	Het
Krt6a	A	G	15: 101,693,869	V127A	probably damaging	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Mgea5	A	T	19: 45,773,668	W249R	probably damaging	Het
Mtfr2	A	T	10: 20,354,154	N153Y	probably damaging	Het
Npas3	G	A	12: 54,044,679	V339I	probably damaging	Het
Nsun2	C	T	13: 69,627,645	R438C	probably damaging	Het
Olfr1140	T	A	2: 87,747,048	M284K	probably damaging	Het
Olfr1231	T	A	2: 89,303,251	I114F	possibly damaging	Het
Olfr1297	A	C	2: 111,622,067	D2E	probably benign	Het
Pgm2	A	G	4: 99,986,678	M553V	probably benign	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Ppp2r5e	A	G	12: 75,464,929	I340T	probably damaging	Het
Qprt	C	A	7: 127,108,824	R145L	probably damaging	Het
Sertad4	T	C	1: 192,846,521	D329G	probably benign	Het
Setd2	C	T	9: 110,602,187	T583M		Het
Slc12a7	T	C	13: 73,799,720	I652T	probably damaging	Het
Slc27a5	T	C	7: 12,989,402	D539G	probably damaging	Het
Slc36a2	A	G	11: 55,164,269	I320T	probably benign	Het
Slc6a20a	A	G	9: 123,637,852	Y524H	probably damaging	Het
Slc6a20a	T	A	9: 123,664,574	S81C	probably damaging	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Stag3	T	C	5: 138,301,203	M828T	possibly damaging	Het
Stk36	T	C	1: 74,612,766	V406A	probably benign	Het
Svep1	G	T	4: 58,146,637	P335Q	probably damaging	Het
Svs5	T	A	2: 164,333,421	S64R	possibly damaging	Het
Taf2	A	G	15: 55,064,617	V130A	possibly damaging	Het
Tbrg4	C	T	11: 6,618,517	V421M	probably damaging	Het
Tbx4	G	T	11: 85,914,160	K358N	probably damaging	Het
Tenm4	A	T	7: 96,704,041	T384S	probably damaging	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Zfp574	T	A	7: 25,080,670	C372*	probably null	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
R8768:Pdzd2	UTSW	15	12437166	missense	probably damaging	1.00
R8879:Pdzd2	UTSW	15	12402319	missense	probably damaging	1.00
R9019:Pdzd2	UTSW	15	12375526	missense	probably damaging	1.00
R9030:Pdzd2	UTSW	15	12374299	missense	probably benign	0.02
R9061:Pdzd2	UTSW	15	12374667	missense	possibly damaging	0.94
R9302:Pdzd2	UTSW	15	12374256	missense	possibly damaging	0.61
R9321:Pdzd2	UTSW	15	12385937	missense	probably benign	0.00
R9421:Pdzd2	UTSW	15	12375028	missense
R9515:Pdzd2	UTSW	15	12374535	missense	probably damaging	1.00
R9592:Pdzd2	UTSW	15	12458020	missense	probably damaging	1.00
R9614:Pdzd2	UTSW	15	12375400	missense	probably damaging	1.00
R9630:Pdzd2	UTSW	15	12374357	missense	probably benign	0.37
R9776:Pdzd2	UTSW	15	12457823	missense	probably benign	0.03
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCTGTGGAGATGGGAATAC -3'
(R):5'- CTACTACTGTGAGCAGAGCTGG -3'

Sequencing Primer
(F):5'- ATTCTGCCTGGAGACAGT -3'
(R):5'- GAGCTGGCCCCATGAATCTAC -3'

Posted On

2020-06-30