Incidental Mutation 'R8017:Pdzd2'
ID 628838
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene Name PDZ domain containing 2
Synonyms Gm21706, A930022H17Rik, Pdzk3, 4930537L06Rik, LOC223364
MMRRC Submission 067457-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8017 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 12359797-12740010 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12373122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 2338 (R2338G)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075317
AA Change: R2338G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: R2338G

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,744,469 (GRCm39) A51E unknown Het
A2ml1 C T 6: 128,558,410 (GRCm39) probably null Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Bnc2 A G 4: 84,329,662 (GRCm39) L118P Het
Ccdc18 T A 5: 108,376,511 (GRCm39) Y1317* probably null Het
Ccdc93 C T 1: 121,375,993 (GRCm39) T168M probably damaging Het
Cd109 G T 9: 78,614,828 (GRCm39) D1292Y possibly damaging Het
Cdh24 G T 14: 54,876,089 (GRCm39) N184K probably damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cspg4b T A 13: 113,456,157 (GRCm39) S734R Het
Efemp2 T A 19: 5,527,708 (GRCm39) C181* probably null Het
Eftud2 A G 11: 102,734,174 (GRCm39) probably null Het
Elp2 G A 18: 24,739,920 (GRCm39) V49M possibly damaging Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Exph5 G A 9: 53,284,752 (GRCm39) C611Y probably benign Het
Gm9376 T G 14: 118,504,951 (GRCm39) Y128D probably damaging Het
Gsdmc2 T A 15: 63,698,762 (GRCm39) N278I probably benign Het
Hace1 C T 10: 45,514,478 (GRCm39) T199M probably damaging Het
Hivep1 T C 13: 42,321,098 (GRCm39) V44A Het
Homez A C 14: 55,095,689 (GRCm39) D6E probably benign Het
Ighv5-12 A T 12: 113,665,792 (GRCm39) M102K probably damaging Het
Jup T C 11: 100,265,023 (GRCm39) T643A probably benign Het
Krt4 T A 15: 101,828,722 (GRCm39) I381F probably damaging Het
Krt6a A G 15: 101,602,304 (GRCm39) V127A probably damaging Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Mtfr2 A T 10: 20,229,900 (GRCm39) N153Y probably damaging Het
Npas3 G A 12: 54,091,462 (GRCm39) V339I probably damaging Het
Nsun2 C T 13: 69,775,764 (GRCm39) R438C probably damaging Het
Oga A T 19: 45,762,107 (GRCm39) W249R probably damaging Het
Or4c1 T A 2: 89,133,595 (GRCm39) I114F possibly damaging Het
Or4k47 A C 2: 111,452,412 (GRCm39) D2E probably benign Het
Or5w16 T A 2: 87,577,392 (GRCm39) M284K probably damaging Het
Pgm1 A G 4: 99,843,875 (GRCm39) M553V probably benign Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Ppp2r5e A G 12: 75,511,703 (GRCm39) I340T probably damaging Het
Qprt C A 7: 126,707,996 (GRCm39) R145L probably damaging Het
Sertad4 T C 1: 192,528,829 (GRCm39) D329G probably benign Het
Setd2 C T 9: 110,431,255 (GRCm39) T583M Het
Slc12a7 T C 13: 73,947,839 (GRCm39) I652T probably damaging Het
Slc27a5 T C 7: 12,723,329 (GRCm39) D539G probably damaging Het
Slc36a2 A G 11: 55,055,095 (GRCm39) I320T probably benign Het
Slc6a20a A G 9: 123,466,917 (GRCm39) Y524H probably damaging Het
Slc6a20a T A 9: 123,493,639 (GRCm39) S81C probably damaging Het
St6gal1 G A 16: 23,176,585 (GRCm39) A393T probably benign Het
Stag3 T C 5: 138,299,465 (GRCm39) M828T possibly damaging Het
Stk36 T C 1: 74,651,925 (GRCm39) V406A probably benign Het
Svep1 G T 4: 58,146,637 (GRCm39) P335Q probably damaging Het
Svs5 T A 2: 164,175,341 (GRCm39) S64R possibly damaging Het
Taf2 A G 15: 54,928,013 (GRCm39) V130A possibly damaging Het
Tbrg4 C T 11: 6,568,517 (GRCm39) V421M probably damaging Het
Tbx4 G T 11: 85,804,986 (GRCm39) K358N probably damaging Het
Tenm4 A T 7: 96,353,248 (GRCm39) T384S probably damaging Het
Tubg1 G T 11: 101,014,854 (GRCm39) A199S probably benign Het
Zfp574 T A 7: 24,780,095 (GRCm39) C372* probably null Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12,458,069 (GRCm39) missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12,365,853 (GRCm39) splice site probably null
IGL00697:Pdzd2 APN 15 12,373,733 (GRCm39) missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12,374,498 (GRCm39) missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12,374,804 (GRCm39) missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12,402,718 (GRCm39) unclassified probably benign
IGL01389:Pdzd2 APN 15 12,374,712 (GRCm39) missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12,458,293 (GRCm39) missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12,445,750 (GRCm39) missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12,592,569 (GRCm39) missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12,372,632 (GRCm39) missense probably benign
IGL01915:Pdzd2 APN 15 12,371,725 (GRCm39) missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12,592,440 (GRCm39) missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12,376,382 (GRCm39) missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12,445,735 (GRCm39) missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12,375,851 (GRCm39) missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12,411,105 (GRCm39) missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12,385,720 (GRCm39) missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12,592,329 (GRCm39) missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12,376,113 (GRCm39) missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12,374,427 (GRCm39) missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12,382,708 (GRCm39) missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12,385,351 (GRCm39) missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12,388,628 (GRCm39) critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12,373,850 (GRCm39) missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12,399,374 (GRCm39) missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12,371,691 (GRCm39) missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12,368,027 (GRCm39) missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12,368,027 (GRCm39) missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12,375,110 (GRCm39) missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12,592,246 (GRCm39) missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12,592,364 (GRCm39) missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12,376,385 (GRCm39) missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12,458,144 (GRCm39) missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12,399,356 (GRCm39) missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12,374,594 (GRCm39) missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12,371,725 (GRCm39) missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12,390,052 (GRCm39) critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12,373,173 (GRCm39) missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12,457,981 (GRCm39) missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12,458,306 (GRCm39) missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12,385,525 (GRCm39) missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12,411,108 (GRCm39) missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12,373,915 (GRCm39) missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12,373,047 (GRCm39) missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12,385,950 (GRCm39) missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12,592,546 (GRCm39) missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12,387,740 (GRCm39) missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12,390,134 (GRCm39) missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12,373,941 (GRCm39) missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12,457,972 (GRCm39) missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12,373,986 (GRCm39) missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12,373,676 (GRCm39) missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12,406,645 (GRCm39) missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12,375,879 (GRCm39) missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12,373,934 (GRCm39) missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12,373,247 (GRCm39) missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12,375,557 (GRCm39) missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12,376,262 (GRCm39) missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12,375,594 (GRCm39) missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12,387,732 (GRCm39) missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12,376,061 (GRCm39) missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12,385,723 (GRCm39) missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12,419,567 (GRCm39) missense possibly damaging 0.48
R4492:Pdzd2 UTSW 15 12,385,723 (GRCm39) missense possibly damaging 0.75
R4656:Pdzd2 UTSW 15 12,385,797 (GRCm39) missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12,419,602 (GRCm39) missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12,374,681 (GRCm39) missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12,385,429 (GRCm39) missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12,375,734 (GRCm39) missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12,375,734 (GRCm39) missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12,592,494 (GRCm39) nonsense probably null
R5174:Pdzd2 UTSW 15 12,372,600 (GRCm39) missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12,390,119 (GRCm39) missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12,373,028 (GRCm39) missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12,592,263 (GRCm39) missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12,382,762 (GRCm39) missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12,382,762 (GRCm39) missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12,374,367 (GRCm39) missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12,592,436 (GRCm39) nonsense probably null
R5704:Pdzd2 UTSW 15 12,385,761 (GRCm39) missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12,442,675 (GRCm39) missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12,592,656 (GRCm39) splice site probably null
R6222:Pdzd2 UTSW 15 12,374,652 (GRCm39) missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12,458,274 (GRCm39) missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12,592,551 (GRCm39) missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12,385,951 (GRCm39) missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12,374,123 (GRCm39) missense probably benign
R6955:Pdzd2 UTSW 15 12,401,550 (GRCm39) missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12,375,993 (GRCm39) missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12,457,945 (GRCm39) missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12,373,061 (GRCm39) missense probably benign 0.14
R7014:Pdzd2 UTSW 15 12,372,647 (GRCm39) missense probably benign 0.13
R7110:Pdzd2 UTSW 15 12,368,099 (GRCm39) missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12,376,209 (GRCm39) missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12,458,231 (GRCm39) nonsense probably null
R7228:Pdzd2 UTSW 15 12,373,059 (GRCm39) missense probably benign 0.01
R7317:Pdzd2 UTSW 15 12,592,329 (GRCm39) missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12,437,248 (GRCm39) missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12,399,291 (GRCm39) missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12,372,820 (GRCm39) missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12,373,289 (GRCm39) missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12,407,422 (GRCm39) missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12,373,460 (GRCm39) missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12,374,102 (GRCm39) missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12,385,872 (GRCm39) missense possibly damaging 0.60
R8019:Pdzd2 UTSW 15 12,373,122 (GRCm39) missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12,407,458 (GRCm39) missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12,592,249 (GRCm39) missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12,375,995 (GRCm39) missense probably benign
R8768:Pdzd2 UTSW 15 12,437,252 (GRCm39) missense probably damaging 1.00
R8879:Pdzd2 UTSW 15 12,402,405 (GRCm39) missense probably damaging 1.00
R9019:Pdzd2 UTSW 15 12,375,612 (GRCm39) missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12,374,385 (GRCm39) missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12,374,753 (GRCm39) missense possibly damaging 0.94
R9302:Pdzd2 UTSW 15 12,374,342 (GRCm39) missense possibly damaging 0.61
R9321:Pdzd2 UTSW 15 12,386,023 (GRCm39) missense probably benign 0.00
R9421:Pdzd2 UTSW 15 12,375,114 (GRCm39) missense
R9515:Pdzd2 UTSW 15 12,374,621 (GRCm39) missense probably damaging 1.00
R9592:Pdzd2 UTSW 15 12,458,106 (GRCm39) missense probably damaging 1.00
R9614:Pdzd2 UTSW 15 12,375,486 (GRCm39) missense probably damaging 1.00
R9630:Pdzd2 UTSW 15 12,374,443 (GRCm39) missense probably benign 0.37
R9776:Pdzd2 UTSW 15 12,457,909 (GRCm39) missense probably benign 0.03
X0057:Pdzd2 UTSW 15 12,411,113 (GRCm39) missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12,368,805 (GRCm39) missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12,372,942 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTGTGGAGATGGGAATAC -3'
(R):5'- CTACTACTGTGAGCAGAGCTGG -3'

Sequencing Primer
(F):5'- ATTCTGCCTGGAGACAGT -3'
(R):5'- GAGCTGGCCCCATGAATCTAC -3'
Posted On 2020-06-30