Incidental Mutation 'R8017:Krt6a'
ID 628841
Institutional Source Beutler Lab
Gene Symbol Krt6a
Ensembl Gene ENSMUSG00000058354
Gene Name keratin 6A
Synonyms Krt2-6a, MK6a, Krt2-6c, mK6[a]
MMRRC Submission 067457-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R8017 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101598363-101602740 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101602304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 127 (V127A)
Ref Sequence ENSEMBL: ENSMUSP00000023788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023788]
AlphaFold P50446
Predicted Effect probably damaging
Transcript: ENSMUST00000023788
AA Change: V127A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023788
Gene: ENSMUSG00000058354
AA Change: V127A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 4.1e-36 PFAM
Filament 151 464 7.2e-178 SMART
low complexity region 483 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,744,469 (GRCm39) A51E unknown Het
A2ml1 C T 6: 128,558,410 (GRCm39) probably null Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Bnc2 A G 4: 84,329,662 (GRCm39) L118P Het
Ccdc18 T A 5: 108,376,511 (GRCm39) Y1317* probably null Het
Ccdc93 C T 1: 121,375,993 (GRCm39) T168M probably damaging Het
Cd109 G T 9: 78,614,828 (GRCm39) D1292Y possibly damaging Het
Cdh24 G T 14: 54,876,089 (GRCm39) N184K probably damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cspg4b T A 13: 113,456,157 (GRCm39) S734R Het
Efemp2 T A 19: 5,527,708 (GRCm39) C181* probably null Het
Eftud2 A G 11: 102,734,174 (GRCm39) probably null Het
Elp2 G A 18: 24,739,920 (GRCm39) V49M possibly damaging Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Exph5 G A 9: 53,284,752 (GRCm39) C611Y probably benign Het
Gm9376 T G 14: 118,504,951 (GRCm39) Y128D probably damaging Het
Gsdmc2 T A 15: 63,698,762 (GRCm39) N278I probably benign Het
Hace1 C T 10: 45,514,478 (GRCm39) T199M probably damaging Het
Hivep1 T C 13: 42,321,098 (GRCm39) V44A Het
Homez A C 14: 55,095,689 (GRCm39) D6E probably benign Het
Ighv5-12 A T 12: 113,665,792 (GRCm39) M102K probably damaging Het
Jup T C 11: 100,265,023 (GRCm39) T643A probably benign Het
Krt4 T A 15: 101,828,722 (GRCm39) I381F probably damaging Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Mtfr2 A T 10: 20,229,900 (GRCm39) N153Y probably damaging Het
Npas3 G A 12: 54,091,462 (GRCm39) V339I probably damaging Het
Nsun2 C T 13: 69,775,764 (GRCm39) R438C probably damaging Het
Oga A T 19: 45,762,107 (GRCm39) W249R probably damaging Het
Or4c1 T A 2: 89,133,595 (GRCm39) I114F possibly damaging Het
Or4k47 A C 2: 111,452,412 (GRCm39) D2E probably benign Het
Or5w16 T A 2: 87,577,392 (GRCm39) M284K probably damaging Het
Pdzd2 T C 15: 12,373,122 (GRCm39) R2338G probably damaging Het
Pgm1 A G 4: 99,843,875 (GRCm39) M553V probably benign Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Ppp2r5e A G 12: 75,511,703 (GRCm39) I340T probably damaging Het
Qprt C A 7: 126,707,996 (GRCm39) R145L probably damaging Het
Sertad4 T C 1: 192,528,829 (GRCm39) D329G probably benign Het
Setd2 C T 9: 110,431,255 (GRCm39) T583M Het
Slc12a7 T C 13: 73,947,839 (GRCm39) I652T probably damaging Het
Slc27a5 T C 7: 12,723,329 (GRCm39) D539G probably damaging Het
Slc36a2 A G 11: 55,055,095 (GRCm39) I320T probably benign Het
Slc6a20a A G 9: 123,466,917 (GRCm39) Y524H probably damaging Het
Slc6a20a T A 9: 123,493,639 (GRCm39) S81C probably damaging Het
St6gal1 G A 16: 23,176,585 (GRCm39) A393T probably benign Het
Stag3 T C 5: 138,299,465 (GRCm39) M828T possibly damaging Het
Stk36 T C 1: 74,651,925 (GRCm39) V406A probably benign Het
Svep1 G T 4: 58,146,637 (GRCm39) P335Q probably damaging Het
Svs5 T A 2: 164,175,341 (GRCm39) S64R possibly damaging Het
Taf2 A G 15: 54,928,013 (GRCm39) V130A possibly damaging Het
Tbrg4 C T 11: 6,568,517 (GRCm39) V421M probably damaging Het
Tbx4 G T 11: 85,804,986 (GRCm39) K358N probably damaging Het
Tenm4 A T 7: 96,353,248 (GRCm39) T384S probably damaging Het
Tubg1 G T 11: 101,014,854 (GRCm39) A199S probably benign Het
Zfp574 T A 7: 24,780,095 (GRCm39) C372* probably null Het
Other mutations in Krt6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Krt6a APN 15 101,601,229 (GRCm39) missense probably damaging 1.00
IGL00596:Krt6a APN 15 101,602,665 (GRCm39) missense possibly damaging 0.53
PIT4468001:Krt6a UTSW 15 101,602,352 (GRCm39) missense probably damaging 0.98
R0024:Krt6a UTSW 15 101,599,150 (GRCm39) splice site probably benign
R0024:Krt6a UTSW 15 101,599,150 (GRCm39) splice site probably benign
R0811:Krt6a UTSW 15 101,601,183 (GRCm39) missense probably damaging 1.00
R0812:Krt6a UTSW 15 101,601,183 (GRCm39) missense probably damaging 1.00
R0828:Krt6a UTSW 15 101,602,271 (GRCm39) missense probably damaging 0.99
R0924:Krt6a UTSW 15 101,599,235 (GRCm39) splice site probably benign
R1525:Krt6a UTSW 15 101,602,637 (GRCm39) missense probably benign
R1591:Krt6a UTSW 15 101,600,792 (GRCm39) splice site probably null
R1725:Krt6a UTSW 15 101,600,992 (GRCm39) missense probably damaging 1.00
R1962:Krt6a UTSW 15 101,599,900 (GRCm39) missense probably damaging 1.00
R2201:Krt6a UTSW 15 101,601,606 (GRCm39) missense probably benign 0.41
R3024:Krt6a UTSW 15 101,599,724 (GRCm39) missense probably benign 0.02
R3158:Krt6a UTSW 15 101,599,801 (GRCm39) missense probably damaging 1.00
R5369:Krt6a UTSW 15 101,600,993 (GRCm39) missense probably benign 0.06
R5637:Krt6a UTSW 15 101,600,714 (GRCm39) missense probably benign 0.25
R6164:Krt6a UTSW 15 101,601,008 (GRCm39) missense probably damaging 0.99
R6320:Krt6a UTSW 15 101,600,744 (GRCm39) missense probably damaging 0.99
R6562:Krt6a UTSW 15 101,600,094 (GRCm39) missense probably benign 0.36
R7267:Krt6a UTSW 15 101,602,289 (GRCm39) missense probably benign 0.03
R7560:Krt6a UTSW 15 101,598,994 (GRCm39) missense unknown
R7621:Krt6a UTSW 15 101,600,187 (GRCm39) missense possibly damaging 0.92
R7671:Krt6a UTSW 15 101,598,978 (GRCm39) missense unknown
R8019:Krt6a UTSW 15 101,602,304 (GRCm39) missense probably damaging 1.00
R8318:Krt6a UTSW 15 101,602,682 (GRCm39) start codon destroyed probably null 0.02
R8508:Krt6a UTSW 15 101,601,170 (GRCm39) missense probably damaging 1.00
R9183:Krt6a UTSW 15 101,601,446 (GRCm39) missense probably benign 0.03
R9652:Krt6a UTSW 15 101,599,120 (GRCm39) missense probably benign 0.35
X0067:Krt6a UTSW 15 101,602,212 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GAGCTGAGACTGAAGCCTCTTC -3'
(R):5'- TCCAAGAGGATCTCCATCGGAG -3'

Sequencing Primer
(F):5'- TGTTCAGCATTCCCTGTAGACACAC -3'
(R):5'- TCCATCGGAGGGGGCAG -3'
Posted On 2020-06-30