Mutagenetix > Incidental Mutation

Incidental Mutation 'R8017:Mgea5'

628848

Institutional Source

Beutler Lab

Gene Symbol

Mgea5

Ensembl Gene

ENSMUSG00000025220

Gene Name

meningioma expressed antigen 5 (hyaluronidase)

Synonyms

2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik

MMRRC Submission

067457-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8017 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45750261-45783520 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 45773668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 249 (W249R)

Ref Sequence

ENSEMBL: ENSMUSP00000026243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026243]

AlphaFold

Q9EQQ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000026243
AA Change: W249R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: W249R

Domain	Start	End	E-Value	Type
low complexity region	44	57	N/A	INTRINSIC
Pfam:NAGidase	62	361	2.5e-84	PFAM
low complexity region	453	458	N/A	INTRINSIC
PDB:4BMH\|A	700	915	1e-13	PDB
SCOP:d1cjwa_	715	916	1e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110065P20Rik	G	T	4: 124,850,676	A51E	unknown	Het
A2ml1	C	T	6: 128,581,447		probably null	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
BC067074	T	A	13: 113,319,623	S734R		Het
Bnc2	A	G	4: 84,411,425	L118P		Het
Ccdc18	T	A	5: 108,228,645	Y1317*	probably null	Het
Ccdc93	C	T	1: 121,448,264	T168M	probably damaging	Het
Cd109	G	T	9: 78,707,546	D1292Y	possibly damaging	Het
Cdh24	G	T	14: 54,638,632	N184K	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Efemp2	T	A	19: 5,477,680	C181*	probably null	Het
Eftud2	A	G	11: 102,843,348		probably null	Het
Elp2	G	A	18: 24,606,863	V49M	possibly damaging	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Exph5	G	A	9: 53,373,452	C611Y	probably benign	Het
Gm9376	T	G	14: 118,267,539	Y128D	probably damaging	Het
Gsdmc2	T	A	15: 63,826,913	N278I	probably benign	Het
Hace1	C	T	10: 45,638,382	T199M	probably damaging	Het
Hivep1	T	C	13: 42,167,622	V44A		Het
Homez	A	C	14: 54,858,232	D6E	probably benign	Het
Ighv5-12	A	T	12: 113,702,172	M102K	probably damaging	Het
Jup	T	C	11: 100,374,197	T643A	probably benign	Het
Krt4	T	A	15: 101,920,287	I381F	probably damaging	Het
Krt6a	A	G	15: 101,693,869	V127A	probably damaging	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Mtfr2	A	T	10: 20,354,154	N153Y	probably damaging	Het
Npas3	G	A	12: 54,044,679	V339I	probably damaging	Het
Nsun2	C	T	13: 69,627,645	R438C	probably damaging	Het
Olfr1140	T	A	2: 87,747,048	M284K	probably damaging	Het
Olfr1231	T	A	2: 89,303,251	I114F	possibly damaging	Het
Olfr1297	A	C	2: 111,622,067	D2E	probably benign	Het
Pdzd2	T	C	15: 12,373,036	R2338G	probably damaging	Het
Pgm2	A	G	4: 99,986,678	M553V	probably benign	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Ppp2r5e	A	G	12: 75,464,929	I340T	probably damaging	Het
Qprt	C	A	7: 127,108,824	R145L	probably damaging	Het
Sertad4	T	C	1: 192,846,521	D329G	probably benign	Het
Setd2	C	T	9: 110,602,187	T583M		Het
Slc12a7	T	C	13: 73,799,720	I652T	probably damaging	Het
Slc27a5	T	C	7: 12,989,402	D539G	probably damaging	Het
Slc36a2	A	G	11: 55,164,269	I320T	probably benign	Het
Slc6a20a	A	G	9: 123,637,852	Y524H	probably damaging	Het
Slc6a20a	T	A	9: 123,664,574	S81C	probably damaging	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Stag3	T	C	5: 138,301,203	M828T	possibly damaging	Het
Stk36	T	C	1: 74,612,766	V406A	probably benign	Het
Svep1	G	T	4: 58,146,637	P335Q	probably damaging	Het
Svs5	T	A	2: 164,333,421	S64R	possibly damaging	Het
Taf2	A	G	15: 55,064,617	V130A	possibly damaging	Het
Tbrg4	C	T	11: 6,618,517	V421M	probably damaging	Het
Tbx4	G	T	11: 85,914,160	K358N	probably damaging	Het
Tenm4	A	T	7: 96,704,041	T384S	probably damaging	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Zfp574	T	A	7: 25,080,670	C372*	probably null	Het

Other mutations in Mgea5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00671:Mgea5	APN	19	45765540	missense	possibly damaging	0.89
IGL01845:Mgea5	APN	19	45767862	missense	probably benign	0.00
IGL02039:Mgea5	APN	19	45773703	missense	probably damaging	0.98
IGL02428:Mgea5	APN	19	45765501	missense	probably damaging	1.00
IGL02581:Mgea5	APN	19	45752191	missense	possibly damaging	0.53
IGL02971:Mgea5	APN	19	45762243	missense	probably damaging	1.00
R0127:Mgea5	UTSW	19	45771888	missense	probably damaging	1.00
R0815:Mgea5	UTSW	19	45782986	missense	probably benign	0.00
R0863:Mgea5	UTSW	19	45782986	missense	probably benign	0.00
R1127:Mgea5	UTSW	19	45752155	nonsense	probably null
R1501:Mgea5	UTSW	19	45778640	missense	probably null	1.00
R1514:Mgea5	UTSW	19	45776931	missense	probably damaging	1.00
R1586:Mgea5	UTSW	19	45776910	missense	possibly damaging	0.94
R1716:Mgea5	UTSW	19	45752174	missense	probably benign	0.35
R1755:Mgea5	UTSW	19	45758406	missense	possibly damaging	0.93
R1774:Mgea5	UTSW	19	45776984	missense	probably benign	0.37
R2152:Mgea5	UTSW	19	45758022	nonsense	probably null
R4403:Mgea5	UTSW	19	45778639	missense	probably damaging	1.00
R4664:Mgea5	UTSW	19	45771945	missense	probably benign	0.15
R4971:Mgea5	UTSW	19	45770046	splice site	probably null
R5377:Mgea5	UTSW	19	45758022	nonsense	probably null
R5571:Mgea5	UTSW	19	45777006	missense	probably benign
R5639:Mgea5	UTSW	19	45776999	missense	probably damaging	1.00
R5665:Mgea5	UTSW	19	45776997	missense	probably benign	0.00
R5776:Mgea5	UTSW	19	45771924	missense	probably damaging	1.00
R6050:Mgea5	UTSW	19	45765480	missense	possibly damaging	0.95
R6054:Mgea5	UTSW	19	45776132	missense	probably damaging	1.00
R6317:Mgea5	UTSW	19	45771680	critical splice donor site	probably null
R6410:Mgea5	UTSW	19	45776045	splice site	probably null
R6990:Mgea5	UTSW	19	45767476	missense	probably benign	0.00
R7103:Mgea5	UTSW	19	45783166	start gained	probably benign
R7340:Mgea5	UTSW	19	45767456	nonsense	probably null
R7437:Mgea5	UTSW	19	45778607	missense	possibly damaging	0.76
R7490:Mgea5	UTSW	19	45767447	nonsense	probably null
R7741:Mgea5	UTSW	19	45776062	missense	probably damaging	1.00
R7823:Mgea5	UTSW	19	45776915	missense	possibly damaging	0.51
R8019:Mgea5	UTSW	19	45773668	missense	probably damaging	1.00
R8066:Mgea5	UTSW	19	45771852	missense	probably damaging	0.99
R8075:Mgea5	UTSW	19	45761182	missense	probably damaging	0.97
R8172:Mgea5	UTSW	19	45776900	missense	probably damaging	0.99
R8558:Mgea5	UTSW	19	45758072	missense	probably benign	0.00
R9050:Mgea5	UTSW	19	45767915	missense	probably damaging	1.00
R9150:Mgea5	UTSW	19	45782982	missense	probably benign	0.00
R9404:Mgea5	UTSW	19	45754657	frame shift	probably null
R9562:Mgea5	UTSW	19	45754657	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGTGACACAGCTAAATAGAGTTG -3'
(R):5'- ATACAGAGCCCTTTGTTGTTTG -3'

Sequencing Primer
(F):5'- CTAAATAGAGTTGCCAGATGCCCTG -3'
(R):5'- AGCACTGCAGTCCTGATT -3'

Posted On

2020-06-30