Incidental Mutation 'R8017:Mgea5'
ID628848
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Namemeningioma expressed antigen 5 (hyaluronidase)
Synonyms2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8017 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location45750261-45783520 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45773668 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 249 (W249R)
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
Predicted Effect probably damaging
Transcript: ENSMUST00000026243
AA Change: W249R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: W249R

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,850,676 A51E unknown Het
A2ml1 C T 6: 128,581,447 probably null Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
BC067074 T A 13: 113,319,623 S734R Het
Bnc2 A G 4: 84,411,425 L118P Het
Ccdc18 T A 5: 108,228,645 Y1317* probably null Het
Ccdc93 C T 1: 121,448,264 T168M probably damaging Het
Cd109 G T 9: 78,707,546 D1292Y possibly damaging Het
Cdh24 G T 14: 54,638,632 N184K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Efemp2 T A 19: 5,477,680 C181* probably null Het
Eftud2 A G 11: 102,843,348 probably null Het
Elp2 G A 18: 24,606,863 V49M possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Exph5 G A 9: 53,373,452 C611Y probably benign Het
Gm9376 T G 14: 118,267,539 Y128D probably damaging Het
Gsdmc2 T A 15: 63,826,913 N278I probably benign Het
Hace1 C T 10: 45,638,382 T199M probably damaging Het
Hivep1 T C 13: 42,167,622 V44A Het
Homez A C 14: 54,858,232 D6E probably benign Het
Ighv5-12 A T 12: 113,702,172 M102K probably damaging Het
Jup T C 11: 100,374,197 T643A probably benign Het
Krt4 T A 15: 101,920,287 I381F probably damaging Het
Krt6a A G 15: 101,693,869 V127A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mtfr2 A T 10: 20,354,154 N153Y probably damaging Het
Npas3 G A 12: 54,044,679 V339I probably damaging Het
Nsun2 C T 13: 69,627,645 R438C probably damaging Het
Olfr1140 T A 2: 87,747,048 M284K probably damaging Het
Olfr1231 T A 2: 89,303,251 I114F possibly damaging Het
Olfr1297 A C 2: 111,622,067 D2E probably benign Het
Pdzd2 T C 15: 12,373,036 R2338G probably damaging Het
Pgm2 A G 4: 99,986,678 M553V probably benign Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Ppp2r5e A G 12: 75,464,929 I340T probably damaging Het
Qprt C A 7: 127,108,824 R145L probably damaging Het
Sertad4 T C 1: 192,846,521 D329G probably benign Het
Setd2 C T 9: 110,602,187 T583M Het
Slc12a7 T C 13: 73,799,720 I652T probably damaging Het
Slc27a5 T C 7: 12,989,402 D539G probably damaging Het
Slc36a2 A G 11: 55,164,269 I320T probably benign Het
Slc6a20a A G 9: 123,637,852 Y524H probably damaging Het
Slc6a20a T A 9: 123,664,574 S81C probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stag3 T C 5: 138,301,203 M828T possibly damaging Het
Stk36 T C 1: 74,612,766 V406A probably benign Het
Svep1 G T 4: 58,146,637 P335Q probably damaging Het
Svs5 T A 2: 164,333,421 S64R possibly damaging Het
Taf2 A G 15: 55,064,617 V130A possibly damaging Het
Tbrg4 C T 11: 6,618,517 V421M probably damaging Het
Tbx4 G T 11: 85,914,160 K358N probably damaging Het
Tenm4 A T 7: 96,704,041 T384S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Zfp574 T A 7: 25,080,670 C372* probably null Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R0863:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5377:Mgea5 UTSW 19 45758022 nonsense probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6410:Mgea5 UTSW 19 45776045 splice site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
R7340:Mgea5 UTSW 19 45767456 nonsense probably null
R7437:Mgea5 UTSW 19 45778607 missense possibly damaging 0.76
R7490:Mgea5 UTSW 19 45767447 nonsense probably null
R7741:Mgea5 UTSW 19 45776062 missense probably damaging 1.00
R7823:Mgea5 UTSW 19 45776915 missense possibly damaging 0.51
R8019:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8066:Mgea5 UTSW 19 45771852 missense probably damaging 0.99
R8075:Mgea5 UTSW 19 45761182 missense probably damaging 0.97
R8172:Mgea5 UTSW 19 45776900 missense probably damaging 0.99
R8558:Mgea5 UTSW 19 45758072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGTGACACAGCTAAATAGAGTTG -3'
(R):5'- ATACAGAGCCCTTTGTTGTTTG -3'

Sequencing Primer
(F):5'- CTAAATAGAGTTGCCAGATGCCCTG -3'
(R):5'- AGCACTGCAGTCCTGATT -3'
Posted On2020-06-30