Incidental Mutation 'R8028:Swt1'
ID 628849
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene Name SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms 1200016B10Rik
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 151243450-151304206 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 151260248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 717 (T717K)
Ref Sequence ENSEMBL: ENSMUSP00000067516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000111883]
AlphaFold Q9DBQ9
Predicted Effect probably benign
Transcript: ENSMUST00000064771
AA Change: T717K

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748
AA Change: T717K

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111883
AA Change: D667E

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748
AA Change: D667E

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151,286,890 (GRCm39) missense probably damaging 0.99
IGL01622:Swt1 APN 1 151,286,760 (GRCm39) missense probably benign 0.01
IGL01623:Swt1 APN 1 151,286,760 (GRCm39) missense probably benign 0.01
IGL01672:Swt1 APN 1 151,270,359 (GRCm39) critical splice donor site probably null
IGL01693:Swt1 APN 1 151,297,855 (GRCm39) missense probably benign 0.02
IGL02203:Swt1 APN 1 151,246,377 (GRCm39) missense probably benign 0.01
IGL03223:Swt1 APN 1 151,255,170 (GRCm39) missense possibly damaging 0.80
R0124:Swt1 UTSW 1 151,267,280 (GRCm39) missense probably damaging 1.00
R0496:Swt1 UTSW 1 151,287,021 (GRCm39) missense probably benign
R1037:Swt1 UTSW 1 151,246,320 (GRCm39) splice site probably benign
R1171:Swt1 UTSW 1 151,281,272 (GRCm39) missense probably damaging 1.00
R1270:Swt1 UTSW 1 151,260,142 (GRCm39) missense probably benign 0.00
R1883:Swt1 UTSW 1 151,299,284 (GRCm39) nonsense probably null
R2051:Swt1 UTSW 1 151,248,081 (GRCm39) missense probably damaging 1.00
R2110:Swt1 UTSW 1 151,279,636 (GRCm39) missense probably damaging 0.97
R2185:Swt1 UTSW 1 151,260,219 (GRCm39) missense probably damaging 1.00
R3688:Swt1 UTSW 1 151,267,240 (GRCm39) missense probably damaging 0.99
R3785:Swt1 UTSW 1 151,255,155 (GRCm39) missense probably benign 0.03
R4074:Swt1 UTSW 1 151,270,520 (GRCm39) missense probably benign
R4157:Swt1 UTSW 1 151,278,795 (GRCm39) missense probably damaging 1.00
R4660:Swt1 UTSW 1 151,283,348 (GRCm39) missense probably benign 0.18
R4761:Swt1 UTSW 1 151,276,853 (GRCm39) missense probably benign 0.43
R4972:Swt1 UTSW 1 151,299,293 (GRCm39) missense probably benign 0.22
R5141:Swt1 UTSW 1 151,287,145 (GRCm39) missense probably benign 0.04
R5227:Swt1 UTSW 1 151,278,727 (GRCm39) nonsense probably null
R5400:Swt1 UTSW 1 151,288,585 (GRCm39) missense probably benign 0.00
R5580:Swt1 UTSW 1 151,260,206 (GRCm39) missense probably benign 0.00
R5912:Swt1 UTSW 1 151,287,160 (GRCm39) missense probably damaging 1.00
R5945:Swt1 UTSW 1 151,286,921 (GRCm39) missense probably benign 0.01
R5973:Swt1 UTSW 1 151,278,700 (GRCm39) splice site probably null
R5979:Swt1 UTSW 1 151,283,339 (GRCm39) missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151,283,365 (GRCm39) missense probably benign 0.41
R6283:Swt1 UTSW 1 151,260,084 (GRCm39) missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151,273,019 (GRCm39) missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151,246,381 (GRCm39) missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151,264,428 (GRCm39) missense probably damaging 1.00
R7214:Swt1 UTSW 1 151,270,364 (GRCm39) missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151,264,444 (GRCm39) missense probably benign 0.01
R7439:Swt1 UTSW 1 151,286,815 (GRCm39) missense probably benign 0.04
R7441:Swt1 UTSW 1 151,286,815 (GRCm39) missense probably benign 0.04
R7571:Swt1 UTSW 1 151,270,470 (GRCm39) missense probably benign 0.00
R8225:Swt1 UTSW 1 151,297,859 (GRCm39) missense possibly damaging 0.96
R9075:Swt1 UTSW 1 151,246,245 (GRCm39) intron probably benign
R9100:Swt1 UTSW 1 151,299,256 (GRCm39) critical splice donor site probably null
R9135:Swt1 UTSW 1 151,244,239 (GRCm39) missense possibly damaging 0.61
R9291:Swt1 UTSW 1 151,286,694 (GRCm39) missense probably damaging 0.96
R9292:Swt1 UTSW 1 151,278,787 (GRCm39) missense probably benign 0.00
R9368:Swt1 UTSW 1 151,286,767 (GRCm39) missense possibly damaging 0.90
X0062:Swt1 UTSW 1 151,287,190 (GRCm39) missense probably benign 0.43
Z1176:Swt1 UTSW 1 151,264,436 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCAGAGCTGAATGTCTTGG -3'
(R):5'- TACTATGGTAAGTAGGTCGAGCAG -3'

Sequencing Primer
(F):5'- GCTGAATGTCTTGGGAATTTAATACC -3'
(R):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
Posted On 2020-06-30