Incidental Mutation 'R8028:Arhgap21'
ID628850
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R8028 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20880405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 664 (V664M)
Ref Sequence ENSEMBL: ENSMUSP00000122497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect probably benign
Transcript: ENSMUST00000114594
AA Change: V658M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: V658M

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141298
AA Change: V664M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: V664M

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154230
AA Change: V664M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: V664M

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173194
AA Change: V654M

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: V654M

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174584
AA Change: V493M

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: V493M

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G T 5: 31,487,922 V340F possibly damaging Het
Abca3 G A 17: 24,407,697 R1500Q probably benign Het
Arhgef11 T C 3: 87,735,552 V1464A probably benign Het
Ccdc158 G T 5: 92,634,251 H836Q probably damaging Het
Clcn2 T A 16: 20,708,762 Y584F possibly damaging Het
Csn1s2b G T 5: 87,819,092 M84I probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gimap4 A T 6: 48,690,750 R146S probably damaging Het
Gm20671 T C 5: 32,795,614 N184S possibly damaging Het
Gpr179 T C 11: 97,337,801 E1176G probably damaging Het
Hif1a T C 12: 73,942,027 S589P probably benign Het
Kcna7 T A 7: 45,409,523 C411* probably null Het
Kel C T 6: 41,699,024 S244N probably benign Het
Lama2 A T 10: 27,328,149 S498T probably benign Het
Map4 C T 9: 110,068,744 T846I probably damaging Het
Myh8 T C 11: 67,303,676 V1571A possibly damaging Het
Osbpl5 T C 7: 143,715,735 T47A probably benign Het
Parl T C 16: 20,280,051 K353E probably benign Het
Pcdhb17 G A 18: 37,487,449 S764N probably benign Het
Poglut1 A G 16: 38,534,733 S244P probably damaging Het
Polq C T 16: 37,061,316 H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,579,908 probably benign Het
Sardh C T 2: 27,230,455 M438I probably damaging Het
Slc14a1 T C 18: 78,116,512 I55M probably benign Het
Slc22a12 T A 19: 6,538,439 T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,302,498 probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk38l T C 6: 146,773,383 F382S probably damaging Het
Swt1 G T 1: 151,384,497 T717K probably benign Het
Tmem230 A G 2: 132,244,065 L59P probably benign Het
Vmn2r98 A T 17: 19,053,650 Y53F probably benign Het
Zscan12 C T 13: 21,368,852 S282L probably benign Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20912291 missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20849479 missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20850358 missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20863172 missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20880713 missense possibly damaging 0.80
R7965:Arhgap21 UTSW 2 20849196 missense probably damaging 1.00
R7986:Arhgap21 UTSW 2 20863156 missense probably damaging 1.00
R8209:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8226:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8251:Arhgap21 UTSW 2 20849410 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCTAGCACATCTGGCTGC -3'
(R):5'- AAATTTTCCAACCACGACTGGGG -3'

Sequencing Primer
(F):5'- AGCACATCTGGCTGCTGAATTTC -3'
(R):5'- ACTGGGGTGTCACTTCAAC -3'
Posted On2020-06-30