Mutagenetix > Incidental Mutation

Incidental Mutation 'R8028:Sardh'

628851

Institutional Source

Beutler Lab

Gene Symbol

Sardh

Ensembl Gene

ENSMUSG00000009614

Gene Name

sarcosine dehydrogenase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R8028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27188393-27248337 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 27230455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 438 (M438I)

Ref Sequence

ENSEMBL: ENSMUSP00000099950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102886]

AlphaFold

Q99LB7

Predicted Effect

probably damaging
Transcript: ENSMUST00000102886
AA Change: M438I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: M438I

Domain	Start	End	E-Value	Type
Pfam:DAO	69	428	1.7e-63	PFAM
Pfam:FAO_M	431	486	9.2e-22	PFAM
Pfam:GCV_T	489	799	3.1e-64	PFAM
Pfam:GCV_T_C	807	904	4.7e-16	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.4%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	G	T	5: 31,487,922	V340F	possibly damaging	Het
Abca3	G	A	17: 24,407,697	R1500Q	probably benign	Het
Arhgap21	C	T	2: 20,880,405	V664M	probably benign	Het
Arhgef11	T	C	3: 87,735,552	V1464A	probably benign	Het
Ccdc158	G	T	5: 92,634,251	H836Q	probably damaging	Het
Clcn2	T	A	16: 20,708,762	Y584F	possibly damaging	Het
Csn1s2b	G	T	5: 87,819,092	M84I	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gimap4	A	T	6: 48,690,750	R146S	probably damaging	Het
Gm20671	T	C	5: 32,795,614	N184S	possibly damaging	Het
Gpr179	T	C	11: 97,337,801	E1176G	probably damaging	Het
Hif1a	T	C	12: 73,942,027	S589P	probably benign	Het
Kcna7	T	A	7: 45,409,523	C411*	probably null	Het
Kel	C	T	6: 41,699,024	S244N	probably benign	Het
Lama2	A	T	10: 27,328,149	S498T	probably benign	Het
Map4	C	T	9: 110,068,744	T846I	probably damaging	Het
Myh8	T	C	11: 67,303,676	V1571A	possibly damaging	Het
Osbpl5	T	C	7: 143,715,735	T47A	probably benign	Het
Parl	T	C	16: 20,280,051	K353E	probably benign	Het
Pcdhb17	G	A	18: 37,487,449	S764N	probably benign	Het
Poglut1	A	G	16: 38,534,733	S244P	probably damaging	Het
Polq	C	T	16: 37,061,316	H1281Y	possibly damaging	Het
Rsf1	CG	CGACCGCGGGG	7: 97,579,908		probably benign	Het
Slc14a1	T	C	18: 78,116,512	I55M	probably benign	Het
Slc22a12	T	A	19: 6,538,439	T350S	probably benign	Het
Srrt	CACCTTCTCCCCAGAACCCCACACCTTACCTG	C	5: 137,302,498		probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stk38l	T	C	6: 146,773,383	F382S	probably damaging	Het
Swt1	G	T	1: 151,384,497	T717K	probably benign	Het
Tmem230	A	G	2: 132,244,065	L59P	probably benign	Het
Vmn2r98	A	T	17: 19,053,650	Y53F	probably benign	Het
Zscan12	C	T	13: 21,368,852	S282L	probably benign	Het

Other mutations in Sardh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Sardh	APN	2	27215113	missense	probably benign	0.07
IGL01686:Sardh	APN	2	27189613	missense	probably damaging	1.00
IGL01868:Sardh	APN	2	27227147	missense	probably benign	0.35
IGL02167:Sardh	APN	2	27191975	missense	probably damaging	0.98
IGL02272:Sardh	APN	2	27224991	missense	probably benign	0.00
IGL02870:Sardh	APN	2	27235491	missense	possibly damaging	0.93
IGL03117:Sardh	APN	2	27239446	missense	probably damaging	1.00
PIT4305001:Sardh	UTSW	2	27228314	missense	probably damaging	1.00
PIT4791001:Sardh	UTSW	2	27197648	missense	probably damaging	1.00
R0265:Sardh	UTSW	2	27227066	splice site	probably benign
R0781:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1110:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1242:Sardh	UTSW	2	27235563	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1514:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R1565:Sardh	UTSW	2	27242719	missense	probably damaging	1.00
R1832:Sardh	UTSW	2	27235569	missense	possibly damaging	0.95
R1836:Sardh	UTSW	2	27215182	missense	possibly damaging	0.65
R1997:Sardh	UTSW	2	27244397	missense	probably damaging	0.97
R2006:Sardh	UTSW	2	27228339	missense	probably damaging	1.00
R2046:Sardh	UTSW	2	27215082	missense	possibly damaging	0.95
R2242:Sardh	UTSW	2	27235515	missense	possibly damaging	0.93
R2897:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R4332:Sardh	UTSW	2	27215114	missense	possibly damaging	0.85
R4807:Sardh	UTSW	2	27189527	missense	probably benign	0.00
R4841:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4842:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4856:Sardh	UTSW	2	27244477	missense	probably benign	0.02
R4936:Sardh	UTSW	2	27228241	splice site	probably null
R5089:Sardh	UTSW	2	27239613	critical splice donor site	probably null
R5110:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R5257:Sardh	UTSW	2	27244259	missense	probably damaging	0.98
R5406:Sardh	UTSW	2	27211084	missense	possibly damaging	0.72
R5450:Sardh	UTSW	2	27239698	missense	possibly damaging	0.65
R5594:Sardh	UTSW	2	27220723	missense	probably damaging	1.00
R5870:Sardh	UTSW	2	27220641	critical splice donor site	probably null
R6014:Sardh	UTSW	2	27197528	critical splice donor site	probably null
R6021:Sardh	UTSW	2	27189643	missense	probably benign	0.44
R6470:Sardh	UTSW	2	27244372	missense	probably damaging	1.00
R6577:Sardh	UTSW	2	27218855	missense	possibly damaging	0.95
R6750:Sardh	UTSW	2	27228257	missense	probably benign	0.04
R7035:Sardh	UTSW	2	27230842	missense	probably damaging	1.00
R7162:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R7256:Sardh	UTSW	2	27218812	missense	probably benign
R7692:Sardh	UTSW	2	27197639	missense	probably benign	0.01
R7709:Sardh	UTSW	2	27241517	missense	possibly damaging	0.62
R7884:Sardh	UTSW	2	27239371	missense	probably damaging	0.99
R8095:Sardh	UTSW	2	27242718	missense	probably damaging	1.00
R8120:Sardh	UTSW	2	27218851	missense	possibly damaging	0.62
R8302:Sardh	UTSW	2	27215110	missense	probably benign	0.03
R8323:Sardh	UTSW	2	27235564	missense	probably damaging	1.00
R8535:Sardh	UTSW	2	27239645	missense	probably damaging	1.00
R8704:Sardh	UTSW	2	27230465	missense	possibly damaging	0.50
R8781:Sardh	UTSW	2	27196703	missense	possibly damaging	0.95
R8858:Sardh	UTSW	2	27228290	missense	probably null	1.00
R9265:Sardh	UTSW	2	27215053	missense	probably damaging	0.99
R9337:Sardh	UTSW	2	27196666	missense	probably benign	0.11
R9342:Sardh	UTSW	2	27230857	missense	possibly damaging	0.95
R9539:Sardh	UTSW	2	27244286	missense	probably damaging	0.99
R9600:Sardh	UTSW	2	27230501	missense	probably benign
R9714:Sardh	UTSW	2	27189629	missense	possibly damaging	0.64
X0011:Sardh	UTSW	2	27242746	missense	probably damaging	1.00
Z1176:Sardh	UTSW	2	27196673	missense	probably benign	0.08
Z1176:Sardh	UTSW	2	27218834	missense	possibly damaging	0.88
Z1176:Sardh	UTSW	2	27218890	missense	possibly damaging	0.52
Z1177:Sardh	UTSW	2	27235513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGACACACAGAGACTACGG -3'
(R):5'- ATGAGGACAGGGTTCATGTG -3'

Sequencing Primer
(F):5'- AGAGACTACGGACTGCCC -3'
(R):5'- GGGGCTGCCTGGAGATAG -3'

Posted On

2020-06-30