Incidental Mutation 'R8028:Sardh'
ID 628851
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Name sarcosine dehydrogenase
Synonyms
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 27078405-27138344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27120467 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 438 (M438I)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886]
AlphaFold Q99LB7
Predicted Effect probably damaging
Transcript: ENSMUST00000102886
AA Change: M438I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: M438I

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27,105,125 (GRCm39) missense probably benign 0.07
IGL01686:Sardh APN 2 27,079,625 (GRCm39) missense probably damaging 1.00
IGL01868:Sardh APN 2 27,117,159 (GRCm39) missense probably benign 0.35
IGL02167:Sardh APN 2 27,081,987 (GRCm39) missense probably damaging 0.98
IGL02272:Sardh APN 2 27,115,003 (GRCm39) missense probably benign 0.00
IGL02870:Sardh APN 2 27,125,503 (GRCm39) missense possibly damaging 0.93
IGL03117:Sardh APN 2 27,129,458 (GRCm39) missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27,118,326 (GRCm39) missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27,087,660 (GRCm39) missense probably damaging 1.00
R0265:Sardh UTSW 2 27,117,078 (GRCm39) splice site probably benign
R0781:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1110:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1242:Sardh UTSW 2 27,125,575 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1514:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R1565:Sardh UTSW 2 27,132,731 (GRCm39) missense probably damaging 1.00
R1832:Sardh UTSW 2 27,125,581 (GRCm39) missense possibly damaging 0.95
R1836:Sardh UTSW 2 27,105,194 (GRCm39) missense possibly damaging 0.65
R1997:Sardh UTSW 2 27,134,409 (GRCm39) missense probably damaging 0.97
R2006:Sardh UTSW 2 27,118,351 (GRCm39) missense probably damaging 1.00
R2046:Sardh UTSW 2 27,105,094 (GRCm39) missense possibly damaging 0.95
R2242:Sardh UTSW 2 27,125,527 (GRCm39) missense possibly damaging 0.93
R2897:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R4332:Sardh UTSW 2 27,105,126 (GRCm39) missense possibly damaging 0.85
R4807:Sardh UTSW 2 27,079,539 (GRCm39) missense probably benign 0.00
R4841:Sardh UTSW 2 27,081,967 (GRCm39) missense probably benign 0.09
R4842:Sardh UTSW 2 27,081,967 (GRCm39) missense probably benign 0.09
R4856:Sardh UTSW 2 27,134,489 (GRCm39) missense probably benign 0.02
R4936:Sardh UTSW 2 27,118,253 (GRCm39) splice site probably null
R5089:Sardh UTSW 2 27,129,625 (GRCm39) critical splice donor site probably null
R5110:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R5257:Sardh UTSW 2 27,134,271 (GRCm39) missense probably damaging 0.98
R5406:Sardh UTSW 2 27,101,096 (GRCm39) missense possibly damaging 0.72
R5450:Sardh UTSW 2 27,129,710 (GRCm39) missense possibly damaging 0.65
R5594:Sardh UTSW 2 27,110,735 (GRCm39) missense probably damaging 1.00
R5870:Sardh UTSW 2 27,110,653 (GRCm39) critical splice donor site probably null
R6014:Sardh UTSW 2 27,087,540 (GRCm39) critical splice donor site probably null
R6021:Sardh UTSW 2 27,079,655 (GRCm39) missense probably benign 0.44
R6470:Sardh UTSW 2 27,134,384 (GRCm39) missense probably damaging 1.00
R6577:Sardh UTSW 2 27,108,867 (GRCm39) missense possibly damaging 0.95
R6750:Sardh UTSW 2 27,118,269 (GRCm39) missense probably benign 0.04
R7035:Sardh UTSW 2 27,120,854 (GRCm39) missense probably damaging 1.00
R7162:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R7256:Sardh UTSW 2 27,108,824 (GRCm39) missense probably benign
R7692:Sardh UTSW 2 27,087,651 (GRCm39) missense probably benign 0.01
R7709:Sardh UTSW 2 27,131,529 (GRCm39) missense possibly damaging 0.62
R7884:Sardh UTSW 2 27,129,383 (GRCm39) missense probably damaging 0.99
R8095:Sardh UTSW 2 27,132,730 (GRCm39) missense probably damaging 1.00
R8120:Sardh UTSW 2 27,108,863 (GRCm39) missense possibly damaging 0.62
R8302:Sardh UTSW 2 27,105,122 (GRCm39) missense probably benign 0.03
R8323:Sardh UTSW 2 27,125,576 (GRCm39) missense probably damaging 1.00
R8535:Sardh UTSW 2 27,129,657 (GRCm39) missense probably damaging 1.00
R8704:Sardh UTSW 2 27,120,477 (GRCm39) missense possibly damaging 0.50
R8781:Sardh UTSW 2 27,086,715 (GRCm39) missense possibly damaging 0.95
R8858:Sardh UTSW 2 27,118,302 (GRCm39) missense probably null 1.00
R9265:Sardh UTSW 2 27,105,065 (GRCm39) missense probably damaging 0.99
R9337:Sardh UTSW 2 27,086,678 (GRCm39) missense probably benign 0.11
R9342:Sardh UTSW 2 27,120,869 (GRCm39) missense possibly damaging 0.95
R9539:Sardh UTSW 2 27,134,298 (GRCm39) missense probably damaging 0.99
R9600:Sardh UTSW 2 27,120,513 (GRCm39) missense probably benign
R9714:Sardh UTSW 2 27,079,641 (GRCm39) missense possibly damaging 0.64
X0011:Sardh UTSW 2 27,132,758 (GRCm39) missense probably damaging 1.00
Z1176:Sardh UTSW 2 27,108,902 (GRCm39) missense possibly damaging 0.52
Z1176:Sardh UTSW 2 27,108,846 (GRCm39) missense possibly damaging 0.88
Z1176:Sardh UTSW 2 27,086,685 (GRCm39) missense probably benign 0.08
Z1177:Sardh UTSW 2 27,125,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACACAGAGACTACGG -3'
(R):5'- ATGAGGACAGGGTTCATGTG -3'

Sequencing Primer
(F):5'- AGAGACTACGGACTGCCC -3'
(R):5'- GGGGCTGCCTGGAGATAG -3'
Posted On 2020-06-30