Incidental Mutation 'R8028:Sardh'
ID 628851
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Name sarcosine dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 27188393-27248337 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27230455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 438 (M438I)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886]
AlphaFold Q99LB7
Predicted Effect probably damaging
Transcript: ENSMUST00000102886
AA Change: M438I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: M438I

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G T 5: 31,487,922 V340F possibly damaging Het
Abca3 G A 17: 24,407,697 R1500Q probably benign Het
Arhgap21 C T 2: 20,880,405 V664M probably benign Het
Arhgef11 T C 3: 87,735,552 V1464A probably benign Het
Ccdc158 G T 5: 92,634,251 H836Q probably damaging Het
Clcn2 T A 16: 20,708,762 Y584F possibly damaging Het
Csn1s2b G T 5: 87,819,092 M84I probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gimap4 A T 6: 48,690,750 R146S probably damaging Het
Gm20671 T C 5: 32,795,614 N184S possibly damaging Het
Gpr179 T C 11: 97,337,801 E1176G probably damaging Het
Hif1a T C 12: 73,942,027 S589P probably benign Het
Kcna7 T A 7: 45,409,523 C411* probably null Het
Kel C T 6: 41,699,024 S244N probably benign Het
Lama2 A T 10: 27,328,149 S498T probably benign Het
Map4 C T 9: 110,068,744 T846I probably damaging Het
Myh8 T C 11: 67,303,676 V1571A possibly damaging Het
Osbpl5 T C 7: 143,715,735 T47A probably benign Het
Parl T C 16: 20,280,051 K353E probably benign Het
Pcdhb17 G A 18: 37,487,449 S764N probably benign Het
Poglut1 A G 16: 38,534,733 S244P probably damaging Het
Polq C T 16: 37,061,316 H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,579,908 probably benign Het
Slc14a1 T C 18: 78,116,512 I55M probably benign Het
Slc22a12 T A 19: 6,538,439 T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,302,498 probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk38l T C 6: 146,773,383 F382S probably damaging Het
Swt1 G T 1: 151,384,497 T717K probably benign Het
Tmem230 A G 2: 132,244,065 L59P probably benign Het
Vmn2r98 A T 17: 19,053,650 Y53F probably benign Het
Zscan12 C T 13: 21,368,852 S282L probably benign Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27215113 missense probably benign 0.07
IGL01686:Sardh APN 2 27189613 missense probably damaging 1.00
IGL01868:Sardh APN 2 27227147 missense probably benign 0.35
IGL02167:Sardh APN 2 27191975 missense probably damaging 0.98
IGL02272:Sardh APN 2 27224991 missense probably benign 0.00
IGL02870:Sardh APN 2 27235491 missense possibly damaging 0.93
IGL03117:Sardh APN 2 27239446 missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27228314 missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27197648 missense probably damaging 1.00
R0265:Sardh UTSW 2 27227066 splice site probably benign
R0781:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1110:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1242:Sardh UTSW 2 27235563 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1514:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R1565:Sardh UTSW 2 27242719 missense probably damaging 1.00
R1832:Sardh UTSW 2 27235569 missense possibly damaging 0.95
R1836:Sardh UTSW 2 27215182 missense possibly damaging 0.65
R1997:Sardh UTSW 2 27244397 missense probably damaging 0.97
R2006:Sardh UTSW 2 27228339 missense probably damaging 1.00
R2046:Sardh UTSW 2 27215082 missense possibly damaging 0.95
R2242:Sardh UTSW 2 27235515 missense possibly damaging 0.93
R2897:Sardh UTSW 2 27189547 missense probably benign 0.00
R4332:Sardh UTSW 2 27215114 missense possibly damaging 0.85
R4807:Sardh UTSW 2 27189527 missense probably benign 0.00
R4841:Sardh UTSW 2 27191955 missense probably benign 0.09
R4842:Sardh UTSW 2 27191955 missense probably benign 0.09
R4856:Sardh UTSW 2 27244477 missense probably benign 0.02
R4936:Sardh UTSW 2 27228241 splice site probably null
R5089:Sardh UTSW 2 27239613 critical splice donor site probably null
R5110:Sardh UTSW 2 27189547 missense probably benign 0.00
R5257:Sardh UTSW 2 27244259 missense probably damaging 0.98
R5406:Sardh UTSW 2 27211084 missense possibly damaging 0.72
R5450:Sardh UTSW 2 27239698 missense possibly damaging 0.65
R5594:Sardh UTSW 2 27220723 missense probably damaging 1.00
R5870:Sardh UTSW 2 27220641 critical splice donor site probably null
R6014:Sardh UTSW 2 27197528 critical splice donor site probably null
R6021:Sardh UTSW 2 27189643 missense probably benign 0.44
R6470:Sardh UTSW 2 27244372 missense probably damaging 1.00
R6577:Sardh UTSW 2 27218855 missense possibly damaging 0.95
R6750:Sardh UTSW 2 27228257 missense probably benign 0.04
R7035:Sardh UTSW 2 27230842 missense probably damaging 1.00
R7162:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R7256:Sardh UTSW 2 27218812 missense probably benign
R7692:Sardh UTSW 2 27197639 missense probably benign 0.01
R7709:Sardh UTSW 2 27241517 missense possibly damaging 0.62
R7884:Sardh UTSW 2 27239371 missense probably damaging 0.99
R8095:Sardh UTSW 2 27242718 missense probably damaging 1.00
R8120:Sardh UTSW 2 27218851 missense possibly damaging 0.62
R8302:Sardh UTSW 2 27215110 missense probably benign 0.03
R8323:Sardh UTSW 2 27235564 missense probably damaging 1.00
R8535:Sardh UTSW 2 27239645 missense probably damaging 1.00
R8704:Sardh UTSW 2 27230465 missense possibly damaging 0.50
R8781:Sardh UTSW 2 27196703 missense possibly damaging 0.95
R8858:Sardh UTSW 2 27228290 missense probably null 1.00
R9265:Sardh UTSW 2 27215053 missense probably damaging 0.99
R9337:Sardh UTSW 2 27196666 missense probably benign 0.11
R9342:Sardh UTSW 2 27230857 missense possibly damaging 0.95
R9539:Sardh UTSW 2 27244286 missense probably damaging 0.99
R9600:Sardh UTSW 2 27230501 missense probably benign
R9714:Sardh UTSW 2 27189629 missense possibly damaging 0.64
X0011:Sardh UTSW 2 27242746 missense probably damaging 1.00
Z1176:Sardh UTSW 2 27196673 missense probably benign 0.08
Z1176:Sardh UTSW 2 27218834 missense possibly damaging 0.88
Z1176:Sardh UTSW 2 27218890 missense possibly damaging 0.52
Z1177:Sardh UTSW 2 27235513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACACAGAGACTACGG -3'
(R):5'- ATGAGGACAGGGTTCATGTG -3'

Sequencing Primer
(F):5'- AGAGACTACGGACTGCCC -3'
(R):5'- GGGGCTGCCTGGAGATAG -3'
Posted On 2020-06-30