Incidental Mutation 'R8028:Gm20671'
ID 628857
Institutional Source Beutler Lab
Gene Symbol Gm20671
Ensembl Gene ENSMUSG00000093574
Gene Name predicted gene 20671
Synonyms
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 32894574-32984453 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32952958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 184 (N184S)
Ref Sequence ENSEMBL: ENSMUSP00000124923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: N1864S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: N1864S

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144673
AA Change: N184S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574
AA Change: N184S

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Gm20671
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5271:Gm20671 UTSW 5 32,977,303 (GRCm39) missense possibly damaging 0.86
R5384:Gm20671 UTSW 5 32,977,286 (GRCm39) missense probably damaging 1.00
R6338:Gm20671 UTSW 5 32,977,991 (GRCm39) missense probably damaging 1.00
R7949:Gm20671 UTSW 5 32,977,288 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AACACTGGACTAGATATGGGGC -3'
(R):5'- AGAGTACTTTCCTGGTGTGCC -3'

Sequencing Primer
(F):5'- CTAGATATGGGGCCACCTGTAATC -3'
(R):5'- ACAGTGACAGCTAGTGAG -3'
Posted On 2020-06-30