Incidental Mutation 'R8028:Csn1s2b'
ID 628858
Institutional Source Beutler Lab
Gene Symbol Csn1s2b
Ensembl Gene ENSMUSG00000061388
Gene Name casein alpha s2-like B
Synonyms Csne, Csnd
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8028 (G1)
Quality Score 211.009
Status Validated
Chromosome 5
Chromosomal Location 87955980-87972280 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 87966951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 84 (M84I)
Ref Sequence ENSEMBL: ENSMUSP00000072352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072539] [ENSMUST00000101057] [ENSMUST00000113279] [ENSMUST00000197301]
AlphaFold P02664
Predicted Effect probably benign
Transcript: ENSMUST00000072539
AA Change: M84I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072352
Gene: ENSMUSG00000061388
AA Change: M84I

DomainStartEndE-ValueType
Pfam:Casein 58 136 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101057
Predicted Effect probably benign
Transcript: ENSMUST00000113279
AA Change: M84I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108904
Gene: ENSMUSG00000061388
AA Change: M84I

DomainStartEndE-ValueType
Pfam:Casein 55 133 5.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197301
AA Change: M73I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142449
Gene: ENSMUSG00000061388
AA Change: M73I

DomainStartEndE-ValueType
Pfam:Casein 45 127 7.2e-15 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Csn1s2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Csn1s2b APN 5 87,968,810 (GRCm39) nonsense probably null
IGL01704:Csn1s2b APN 5 87,960,970 (GRCm39) missense probably damaging 1.00
IGL01785:Csn1s2b APN 5 87,957,772 (GRCm39) missense possibly damaging 0.91
IGL02689:Csn1s2b APN 5 87,957,780 (GRCm39) missense probably benign 0.41
R1596:Csn1s2b UTSW 5 87,966,917 (GRCm39) splice site probably benign
R1649:Csn1s2b UTSW 5 87,966,943 (GRCm39) missense probably benign 0.07
R1682:Csn1s2b UTSW 5 87,970,162 (GRCm39) missense probably damaging 0.98
R1747:Csn1s2b UTSW 5 87,964,529 (GRCm39) splice site probably benign
R3123:Csn1s2b UTSW 5 87,966,917 (GRCm39) splice site probably benign
R4667:Csn1s2b UTSW 5 87,970,170 (GRCm39) missense possibly damaging 0.53
R4781:Csn1s2b UTSW 5 87,966,952 (GRCm39) missense possibly damaging 0.77
R4965:Csn1s2b UTSW 5 87,961,820 (GRCm39) missense possibly damaging 0.81
R6013:Csn1s2b UTSW 5 87,972,098 (GRCm39) splice site probably null
R6730:Csn1s2b UTSW 5 87,970,127 (GRCm39) missense probably benign 0.00
R9651:Csn1s2b UTSW 5 87,968,820 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACTCCCATGTGTCAGGAATG -3'
(R):5'- GACTATATATCTCTTCAGGACCTTCAC -3'

Sequencing Primer
(F):5'- CTCCCATGTGTCAGGAATGATAGAG -3'
(R):5'- CAGGACCTTCACATCTATTCATAATG -3'
Posted On 2020-06-30