Incidental Mutation 'R8028:Srrt'
ID628860
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8028 (G1)
Quality Score217.468
Status Validated
Chromosome5
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) CACCTTCTCCCCAGAACCCCACACCTTACCTG to C at 137302498 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040873] [ENSMUST00000196109] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably benign
Transcript: ENSMUST00000040873
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196109
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197466
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199243
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G T 5: 31,487,922 V340F possibly damaging Het
Abca3 G A 17: 24,407,697 R1500Q probably benign Het
Arhgap21 C T 2: 20,880,405 V664M probably benign Het
Arhgef11 T C 3: 87,735,552 V1464A probably benign Het
Ccdc158 G T 5: 92,634,251 H836Q probably damaging Het
Clcn2 T A 16: 20,708,762 Y584F possibly damaging Het
Csn1s2b G T 5: 87,819,092 M84I probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gimap4 A T 6: 48,690,750 R146S probably damaging Het
Gm20671 T C 5: 32,795,614 N184S possibly damaging Het
Gpr179 T C 11: 97,337,801 E1176G probably damaging Het
Hif1a T C 12: 73,942,027 S589P probably benign Het
Kcna7 T A 7: 45,409,523 C411* probably null Het
Kel C T 6: 41,699,024 S244N probably benign Het
Lama2 A T 10: 27,328,149 S498T probably benign Het
Map4 C T 9: 110,068,744 T846I probably damaging Het
Myh8 T C 11: 67,303,676 V1571A possibly damaging Het
Osbpl5 T C 7: 143,715,735 T47A probably benign Het
Parl T C 16: 20,280,051 K353E probably benign Het
Pcdhb17 G A 18: 37,487,449 S764N probably benign Het
Poglut1 A G 16: 38,534,733 S244P probably damaging Het
Polq C T 16: 37,061,316 H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,579,908 probably benign Het
Sardh C T 2: 27,230,455 M438I probably damaging Het
Slc14a1 T C 18: 78,116,512 I55M probably benign Het
Slc22a12 T A 19: 6,538,439 T350S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk38l T C 6: 146,773,383 F382S probably damaging Het
Swt1 G T 1: 151,384,497 T717K probably benign Het
Tmem230 A G 2: 132,244,065 L59P probably benign Het
Vmn2r98 A T 17: 19,053,650 Y53F probably benign Het
Zscan12 C T 13: 21,368,852 S282L probably benign Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0322:Srrt UTSW 5 137296608 missense probably damaging 1.00
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5015:Srrt UTSW 5 137296009 missense probably damaging 1.00
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5351:Srrt UTSW 5 137298284 makesense probably null
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6497:Srrt UTSW 5 137297506 missense probably damaging 1.00
R6755:Srrt UTSW 5 137302930 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
RF018:Srrt UTSW 5 137300000 missense probably benign 0.23
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCACAAAGGCTTGCTTGTGAG -3'
(R):5'- AGACCATATCCTCCGTGTGC -3'

Sequencing Primer
(F):5'- TTGTGAGCAAGACGGAGAGCC -3'
(R):5'- CCTCAGGGATGAGCACAGCTC -3'
Posted On2020-06-30