Mutagenetix > Incidental Mutations

Incidental Mutation 'R8028:Kel'

628862

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R8028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 41699024 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 244 (S244N)

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899]

Predicted Effect

probably benign
Transcript: ENSMUST00000031899
AA Change: S244N

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: S244N

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.4%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	G	T	5: 31,487,922	V340F	possibly damaging	Het
Abca3	G	A	17: 24,407,697	R1500Q	probably benign	Het
Arhgap21	C	T	2: 20,880,405	V664M	probably benign	Het
Arhgef11	T	C	3: 87,735,552	V1464A	probably benign	Het
Ccdc158	G	T	5: 92,634,251	H836Q	probably damaging	Het
Clcn2	T	A	16: 20,708,762	Y584F	possibly damaging	Het
Csn1s2b	G	T	5: 87,819,092	M84I	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gimap4	A	T	6: 48,690,750	R146S	probably damaging	Het
Gm20671	T	C	5: 32,795,614	N184S	possibly damaging	Het
Gpr179	T	C	11: 97,337,801	E1176G	probably damaging	Het
Hif1a	T	C	12: 73,942,027	S589P	probably benign	Het
Kcna7	T	A	7: 45,409,523	C411*	probably null	Het
Lama2	A	T	10: 27,328,149	S498T	probably benign	Het
Map4	C	T	9: 110,068,744	T846I	probably damaging	Het
Myh8	T	C	11: 67,303,676	V1571A	possibly damaging	Het
Osbpl5	T	C	7: 143,715,735	T47A	probably benign	Het
Parl	T	C	16: 20,280,051	K353E	probably benign	Het
Pcdhb17	G	A	18: 37,487,449	S764N	probably benign	Het
Poglut1	A	G	16: 38,534,733	S244P	probably damaging	Het
Polq	C	T	16: 37,061,316	H1281Y	possibly damaging	Het
Rsf1	CG	CGACCGCGGGG	7: 97,579,908		probably benign	Het
Sardh	C	T	2: 27,230,455	M438I	probably damaging	Het
Slc14a1	T	C	18: 78,116,512	I55M	probably benign	Het
Slc22a12	T	A	19: 6,538,439	T350S	probably benign	Het
Srrt	CACCTTCTCCCCAGAACCCCACACCTTACCTG	C	5: 137,302,498		probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stk38l	T	C	6: 146,773,383	F382S	probably damaging	Het
Swt1	G	T	1: 151,384,497	T717K	probably benign	Het
Tmem230	A	G	2: 132,244,065	L59P	probably benign	Het
Vmn2r98	A	T	17: 19,053,650	Y53F	probably benign	Het
Zscan12	C	T	13: 21,368,852	S282L	probably benign	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGAGAGACCATCAAGCACAG -3'
(R):5'- CTCTTGTGTCCAGATAGACCAGC -3'

Sequencing Primer
(F):5'- GAGTCCCCAGACCCTCAG -3'
(R):5'- TAGACCAGCCGGAGTTTGACATTC -3'

Posted On

2020-06-30