Incidental Mutation 'R8028:Rsf1'
ID 628866
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Name remodeling and spacing factor 1
Synonyms 4832420A03Rik, Hbxap, C030033M12Rik, XAP8, p325
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8028 (G1)
Quality Score 127.636
Status Not validated
Chromosome 7
Chromosomal Location 97229103-97341989 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CG to CGACCGCGGGG at 97229115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000146605] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000154853] [ENSMUST00000178078]
AlphaFold E9PWW9
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97,331,096 (GRCm39) critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97,334,791 (GRCm39) missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97,313,977 (GRCm39) critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97,310,782 (GRCm39) missense probably benign 0.00
IGL02487:Rsf1 APN 7 97,288,698 (GRCm39) missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97,310,434 (GRCm39) missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97,310,533 (GRCm39) missense probably benign 0.35
IGL03176:Rsf1 APN 7 97,328,357 (GRCm39) splice site probably benign
IGL03256:Rsf1 APN 7 97,328,211 (GRCm39) missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
BB014:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
BB018:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
FR4976:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
G1Funyon:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
P0023:Rsf1 UTSW 7 97,311,478 (GRCm39) missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97,285,614 (GRCm39) missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97,229,112 (GRCm39) unclassified probably benign
R0392:Rsf1 UTSW 7 97,328,212 (GRCm39) missense probably benign 0.00
R0422:Rsf1 UTSW 7 97,330,024 (GRCm39) missense probably benign 0.04
R0584:Rsf1 UTSW 7 97,311,335 (GRCm39) missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97,311,226 (GRCm39) missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97,328,234 (GRCm39) missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97,229,174 (GRCm39) missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97,318,985 (GRCm39) missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1498:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1525:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1534:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1582:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1591:Rsf1 UTSW 7 97,288,520 (GRCm39) nonsense probably null
R1676:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1695:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1710:Rsf1 UTSW 7 97,311,556 (GRCm39) missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1764:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1823:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1864:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1884:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1897:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1915:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1928:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1958:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1996:Rsf1 UTSW 7 97,313,839 (GRCm39) missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2021:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2022:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R2046:Rsf1 UTSW 7 97,310,884 (GRCm39) missense probably benign 0.00
R2048:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2093:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2103:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2137:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2167:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2179:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2191:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2207:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2211:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2241:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2264:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2283:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2297:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2307:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2419:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2442:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2696:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R2764:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2939:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2965:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2972:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3008:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3013:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3026:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3110:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3147:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R3427:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3610:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R3624:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3753:Rsf1 UTSW 7 97,311,359 (GRCm39) missense probably benign 0.00
R3759:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3780:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3794:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3889:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R3925:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3964:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4037:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4084:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4240:Rsf1 UTSW 7 97,229,142 (GRCm39) unclassified probably benign
R4303:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R4383:Rsf1 UTSW 7 97,334,683 (GRCm39) missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4525:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R4530:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4543:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4632:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4633:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4652:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4675:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R4675:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R4677:Rsf1 UTSW 7 97,329,980 (GRCm39) missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4769:Rsf1 UTSW 7 97,325,429 (GRCm39) missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4820:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4917:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4979:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R5041:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R5125:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R5369:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R5371:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R5403:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R5436:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R5450:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R5532:Rsf1 UTSW 7 97,329,902 (GRCm39) missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97,311,328 (GRCm39) missense probably benign 0.02
R5657:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5689:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5745:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R5748:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R5773:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R5859:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6001:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6001:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6021:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6025:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6036:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6073:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6077:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6102:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6111:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6126:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6128:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6130:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6154:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6154:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6165:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6166:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6182:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6189:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6200:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6210:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6212:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6214:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6215:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6216:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6232:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6235:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6242:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6243:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6244:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6268:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6269:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6273:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6275:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R6286:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6291:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6293:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6297:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6302:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6309:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6312:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6324:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6343:Rsf1 UTSW 7 97,310,124 (GRCm39) missense probably benign 0.30
R6346:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6356:Rsf1 UTSW 7 97,311,141 (GRCm39) missense probably benign
R6370:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6378:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6394:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6398:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6406:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R6413:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6443:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6453:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R6471:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R6473:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6497:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6505:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6561:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6572:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6607:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6611:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6622:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6626:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6636:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6647:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6648:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6669:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6673:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R6679:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6685:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6695:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6697:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6726:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6739:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6747:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6751:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6771:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6773:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6787:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6800:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R6804:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6806:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6815:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6820:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6823:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6829:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6861:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6862:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6869:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6875:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6889:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6897:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6960:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6963:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6967:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6969:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6977:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6996:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7066:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7109:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7127:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R7138:Rsf1 UTSW 7 97,319,002 (GRCm39) missense
R7214:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R7217:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7238:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7246:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R7253:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7294:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7305:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7309:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7352:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7380:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7393:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7395:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7411:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7413:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7481:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7538:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7541:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7545:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7574:Rsf1 UTSW 7 97,310,374 (GRCm39) missense
R7578:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7599:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R7630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7632:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7710:Rsf1 UTSW 7 97,331,041 (GRCm39) missense
R7711:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7715:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7719:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7722:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7729:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7734:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7743:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7761:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7764:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7797:Rsf1 UTSW 7 97,310,692 (GRCm39) missense
R7802:Rsf1 UTSW 7 97,310,979 (GRCm39) missense
R7806:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7821:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7823:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R7824:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7825:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7826:Rsf1 UTSW 7 97,310,368 (GRCm39) unclassified probably benign
R7841:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R7854:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7862:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R7893:Rsf1 UTSW 7 97,311,165 (GRCm39) missense
R7923:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7924:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7927:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7931:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7951:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7957:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7960:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7979:Rsf1 UTSW 7 97,334,920 (GRCm39) missense
R7982:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7991:Rsf1 UTSW 7 97,310,540 (GRCm39) missense
R8030:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8042:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8062:Rsf1 UTSW 7 97,326,594 (GRCm39) missense
R8076:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8117:Rsf1 UTSW 7 97,288,464 (GRCm39) splice site probably null
R8132:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8153:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8155:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8166:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8197:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8235:Rsf1 UTSW 7 97,325,461 (GRCm39) utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R8282:Rsf1 UTSW 7 97,229,127 (GRCm39) frame shift probably null
R8301:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
R8315:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8343:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8370:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R8372:Rsf1 UTSW 7 97,311,624 (GRCm39) missense
R8376:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8382:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8392:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8410:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8443:Rsf1 UTSW 7 97,266,103 (GRCm39) missense
R8502:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8529:Rsf1 UTSW 7 97,320,074 (GRCm39) utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8554:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8558:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8735:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8742:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8772:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8862:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8866:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R8889:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8889:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8891:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8892:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8907:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8907:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R8913:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8916:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R8924:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8940:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8946:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8947:Rsf1 UTSW 7 97,331,059 (GRCm39) unclassified probably benign
R8951:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8975:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9033:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9044:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9060:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9066:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9079:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9080:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9094:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9096:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9101:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9102:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9123:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9125:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9126:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9128:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9157:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9159:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9161:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9187:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R9240:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9250:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9257:Rsf1 UTSW 7 97,334,918 (GRCm39) missense
R9288:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9345:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9406:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9411:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9414:Rsf1 UTSW 7 97,313,765 (GRCm39) critical splice acceptor site probably null
R9420:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R9421:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9423:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9427:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9448:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9452:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R9454:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9467:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R9468:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9483:Rsf1 UTSW 7 97,229,137 (GRCm39) unclassified probably benign
R9488:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R9502:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9507:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9509:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9519:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9526:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9581:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R9590:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9592:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9618:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9685:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9716:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9748:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9774:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9795:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9802:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
RF034:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
RF036:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
X0025:Rsf1 UTSW 7 97,285,651 (GRCm39) missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97,310,031 (GRCm39) nonsense probably null
Y4335:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2020-06-30