Incidental Mutation 'R8028:Map4'
ID 628868
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Name microtubule-associated protein 4
Synonyms MAP 4, Mtap4
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 109760528-109913023 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109897812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 846 (T846I)
Ref Sequence ENSEMBL: ENSMUSP00000035055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165876] [ENSMUST00000198511] [ENSMUST00000199161] [ENSMUST00000199461] [ENSMUST00000199498] [ENSMUST00000199548]
AlphaFold P27546
Predicted Effect probably damaging
Transcript: ENSMUST00000035055
AA Change: T846I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: T846I

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000163979
AA Change: T135I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479
AA Change: T135I

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164930
AA Change: T693I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479
AA Change: T693I

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165876
AA Change: T846I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: T846I

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198511
SMART Domains Protein: ENSMUSP00000142558
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Tubulin-binding 24 54 7.3e-14 PFAM
Pfam:Tubulin-binding 55 85 5.3e-17 PFAM
Pfam:Tubulin-binding 86 116 2.8e-16 PFAM
Pfam:Tubulin-binding 117 148 1.9e-9 PFAM
low complexity region 183 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199161
SMART Domains Protein: ENSMUSP00000143205
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
Pfam:Tubulin-binding 16 46 6.7e-14 PFAM
Pfam:Tubulin-binding 47 77 4.9e-17 PFAM
Pfam:Tubulin-binding 78 108 2.5e-16 PFAM
Pfam:Tubulin-binding 109 140 1.7e-9 PFAM
low complexity region 176 191 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199461
AA Change: T66I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143296
Gene: ENSMUSG00000032479
AA Change: T66I

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1e-13 PFAM
Pfam:Tubulin-binding 147 177 3.8e-16 PFAM
Pfam:Tubulin-binding 178 209 2.6e-9 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199498
AA Change: T693I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479
AA Change: T693I

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199548
AA Change: T66I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143408
Gene: ENSMUSG00000032479
AA Change: T66I

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1.1e-13 PFAM
Pfam:Tubulin-binding 147 177 7.9e-17 PFAM
Pfam:Tubulin-binding 178 208 4.1e-16 PFAM
Pfam:Tubulin-binding 209 240 2.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 109,901,672 (GRCm39) splice site probably benign
IGL01331:Map4 APN 9 109,863,869 (GRCm39) missense probably benign 0.04
IGL01599:Map4 APN 9 109,863,836 (GRCm39) missense probably benign 0.26
IGL01631:Map4 APN 9 109,892,201 (GRCm39) unclassified probably benign
IGL02208:Map4 APN 9 109,807,938 (GRCm39) start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109,828,901 (GRCm39) missense probably benign 0.15
IGL02625:Map4 APN 9 109,893,485 (GRCm39) missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 109,901,682 (GRCm39) missense probably damaging 1.00
R0149:Map4 UTSW 9 109,896,692 (GRCm39) missense probably damaging 0.96
R0384:Map4 UTSW 9 109,863,696 (GRCm39) missense probably damaging 0.99
R0392:Map4 UTSW 9 109,907,113 (GRCm39) missense probably damaging 1.00
R0496:Map4 UTSW 9 109,868,918 (GRCm39) intron probably benign
R0526:Map4 UTSW 9 109,866,346 (GRCm39) splice site probably null
R0555:Map4 UTSW 9 109,808,171 (GRCm39) splice site probably benign
R0571:Map4 UTSW 9 109,865,834 (GRCm39) missense probably benign 0.00
R0698:Map4 UTSW 9 109,897,856 (GRCm39) nonsense probably null
R0762:Map4 UTSW 9 109,867,546 (GRCm39) intron probably benign
R0862:Map4 UTSW 9 109,808,037 (GRCm39) missense probably damaging 1.00
R0864:Map4 UTSW 9 109,808,037 (GRCm39) missense probably damaging 1.00
R1168:Map4 UTSW 9 109,864,032 (GRCm39) missense probably benign 0.00
R1238:Map4 UTSW 9 109,897,648 (GRCm39) missense probably benign 0.00
R1735:Map4 UTSW 9 109,864,023 (GRCm39) missense probably benign 0.00
R1869:Map4 UTSW 9 109,897,996 (GRCm39) missense possibly damaging 0.95
R1869:Map4 UTSW 9 109,864,032 (GRCm39) missense probably benign 0.00
R2196:Map4 UTSW 9 109,900,116 (GRCm39) missense probably damaging 1.00
R2264:Map4 UTSW 9 109,910,525 (GRCm39) missense probably damaging 1.00
R2507:Map4 UTSW 9 109,866,551 (GRCm39) intron probably benign
R2512:Map4 UTSW 9 109,863,770 (GRCm39) missense possibly damaging 0.48
R3087:Map4 UTSW 9 109,882,257 (GRCm39) missense possibly damaging 0.84
R3154:Map4 UTSW 9 109,828,860 (GRCm39) missense probably benign 0.19
R3498:Map4 UTSW 9 109,864,280 (GRCm39) missense probably benign 0.03
R3547:Map4 UTSW 9 109,881,266 (GRCm39) missense possibly damaging 0.61
R3751:Map4 UTSW 9 109,867,742 (GRCm39) intron probably benign
R4036:Map4 UTSW 9 109,861,283 (GRCm39) missense possibly damaging 0.47
R4423:Map4 UTSW 9 109,896,662 (GRCm39) missense probably damaging 1.00
R4505:Map4 UTSW 9 109,861,253 (GRCm39) missense probably benign 0.01
R4561:Map4 UTSW 9 109,881,439 (GRCm39) missense possibly damaging 0.91
R4577:Map4 UTSW 9 109,910,489 (GRCm39) missense possibly damaging 0.48
R4601:Map4 UTSW 9 109,881,887 (GRCm39) missense possibly damaging 0.75
R4795:Map4 UTSW 9 109,864,331 (GRCm39) missense probably benign 0.00
R4801:Map4 UTSW 9 109,864,325 (GRCm39) missense probably benign 0.15
R4802:Map4 UTSW 9 109,864,325 (GRCm39) missense probably benign 0.15
R4999:Map4 UTSW 9 109,867,445 (GRCm39) intron probably benign
R5020:Map4 UTSW 9 109,897,868 (GRCm39) missense probably benign 0.02
R5021:Map4 UTSW 9 109,867,157 (GRCm39) nonsense probably null
R5049:Map4 UTSW 9 109,908,882 (GRCm39) nonsense probably null
R5451:Map4 UTSW 9 109,866,851 (GRCm39) intron probably benign
R5452:Map4 UTSW 9 109,866,851 (GRCm39) intron probably benign
R5453:Map4 UTSW 9 109,866,851 (GRCm39) intron probably benign
R5492:Map4 UTSW 9 109,881,450 (GRCm39) missense possibly damaging 0.68
R5532:Map4 UTSW 9 109,863,746 (GRCm39) missense probably benign 0.24
R5602:Map4 UTSW 9 109,881,768 (GRCm39) missense possibly damaging 0.84
R5628:Map4 UTSW 9 109,910,915 (GRCm39) missense probably benign 0.04
R5896:Map4 UTSW 9 109,901,702 (GRCm39) missense possibly damaging 0.91
R6017:Map4 UTSW 9 109,863,687 (GRCm39) missense probably benign 0.00
R6084:Map4 UTSW 9 109,893,360 (GRCm39) missense probably damaging 1.00
R6294:Map4 UTSW 9 109,831,814 (GRCm39) missense possibly damaging 0.82
R6397:Map4 UTSW 9 109,856,784 (GRCm39) missense possibly damaging 0.78
R6773:Map4 UTSW 9 109,863,993 (GRCm39) missense probably benign 0.00
R6997:Map4 UTSW 9 109,881,982 (GRCm39) missense probably benign 0.35
R7141:Map4 UTSW 9 109,807,938 (GRCm39) start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 109,882,201 (GRCm39) missense probably benign 0.03
R7320:Map4 UTSW 9 109,910,585 (GRCm39) missense probably benign 0.24
R7469:Map4 UTSW 9 109,856,865 (GRCm39) splice site probably null
R7479:Map4 UTSW 9 109,897,892 (GRCm39) missense possibly damaging 0.94
R7487:Map4 UTSW 9 109,856,783 (GRCm39) missense probably damaging 1.00
R7690:Map4 UTSW 9 109,828,861 (GRCm39) missense probably damaging 0.99
R7780:Map4 UTSW 9 109,863,720 (GRCm39) missense probably benign 0.00
R7998:Map4 UTSW 9 109,908,929 (GRCm39) missense probably damaging 1.00
R8557:Map4 UTSW 9 109,893,370 (GRCm39) splice site probably null
R8950:Map4 UTSW 9 109,901,702 (GRCm39) missense possibly damaging 0.91
R8972:Map4 UTSW 9 109,864,185 (GRCm39) missense probably benign
R9145:Map4 UTSW 9 109,855,268 (GRCm39) missense probably damaging 0.99
R9297:Map4 UTSW 9 109,882,480 (GRCm39) missense probably benign 0.02
R9332:Map4 UTSW 9 109,864,223 (GRCm39) missense probably benign 0.00
R9354:Map4 UTSW 9 109,897,847 (GRCm39) missense probably benign
R9419:Map4 UTSW 9 109,882,029 (GRCm39) missense possibly damaging 0.92
R9430:Map4 UTSW 9 109,863,760 (GRCm39) missense probably benign 0.41
R9437:Map4 UTSW 9 109,864,155 (GRCm39) missense possibly damaging 0.46
R9718:Map4 UTSW 9 109,901,774 (GRCm39) critical splice donor site probably null
Z1177:Map4 UTSW 9 109,897,591 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAAACCTGCTGATGTCAAAAGG -3'
(R):5'- TTGGAGCGAACACTCTTCAGG -3'

Sequencing Primer
(F):5'- TTCCCCAGTTCTAAGGCT -3'
(R):5'- AGCGAACACTCTTCAGGTCAGG -3'
Posted On 2020-06-30