Incidental Mutation 'R8028:Lama2'
ID 628869
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Name laminin, alpha 2
Synonyms mer, merosin
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 26857281-27493021 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27204145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 498 (S498T)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
AlphaFold no structure available at present
PDB Structure LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000092639
AA Change: S498T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: S498T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189575
AA Change: S498T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: S498T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27,064,261 (GRCm39) missense probably benign 0.01
IGL00467:Lama2 APN 10 27,343,193 (GRCm39) splice site probably benign
IGL00470:Lama2 APN 10 27,119,738 (GRCm39) missense probably benign 0.22
IGL00517:Lama2 APN 10 27,073,326 (GRCm39) missense probably benign 0.01
IGL00541:Lama2 APN 10 27,064,302 (GRCm39) missense probably benign 0.14
IGL00931:Lama2 APN 10 26,882,772 (GRCm39) missense possibly damaging 0.92
IGL00951:Lama2 APN 10 26,906,281 (GRCm39) missense probably benign 0.03
IGL00988:Lama2 APN 10 27,245,011 (GRCm39) nonsense probably null
IGL01098:Lama2 APN 10 26,907,108 (GRCm39) missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27,084,425 (GRCm39) missense probably benign 0.00
IGL01293:Lama2 APN 10 27,107,632 (GRCm39) missense probably benign 0.38
IGL01338:Lama2 APN 10 27,064,268 (GRCm39) missense probably benign 0.13
IGL01609:Lama2 APN 10 27,220,417 (GRCm39) missense probably benign 0.03
IGL01643:Lama2 APN 10 26,946,368 (GRCm39) splice site probably benign
IGL01675:Lama2 APN 10 27,064,050 (GRCm39) missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27,141,041 (GRCm39) missense probably benign 0.33
IGL01694:Lama2 APN 10 26,882,738 (GRCm39) missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27,065,270 (GRCm39) splice site probably benign
IGL01885:Lama2 APN 10 26,981,135 (GRCm39) nonsense probably null
IGL01935:Lama2 APN 10 27,298,600 (GRCm39) missense probably damaging 0.98
IGL01994:Lama2 APN 10 27,343,199 (GRCm39) critical splice donor site probably null
IGL02041:Lama2 APN 10 26,860,322 (GRCm39) missense probably damaging 1.00
IGL02067:Lama2 APN 10 27,052,792 (GRCm39) missense probably benign 0.02
IGL02097:Lama2 APN 10 27,014,956 (GRCm39) missense probably benign 0.09
IGL02179:Lama2 APN 10 26,946,360 (GRCm39) missense probably benign 0.01
IGL02268:Lama2 APN 10 26,877,112 (GRCm39) splice site probably benign
IGL02302:Lama2 APN 10 27,088,039 (GRCm39) missense probably benign 0.06
IGL02363:Lama2 APN 10 27,242,062 (GRCm39) missense probably damaging 1.00
IGL02378:Lama2 APN 10 26,919,652 (GRCm39) missense probably damaging 0.99
IGL02642:Lama2 APN 10 27,343,269 (GRCm39) missense probably damaging 1.00
IGL02676:Lama2 APN 10 26,994,489 (GRCm39) missense probably benign 0.00
IGL02695:Lama2 APN 10 26,876,771 (GRCm39) missense probably benign
IGL02735:Lama2 APN 10 26,980,124 (GRCm39) missense probably damaging 1.00
IGL02794:Lama2 APN 10 26,917,227 (GRCm39) missense possibly damaging 0.73
IGL02823:Lama2 APN 10 26,877,141 (GRCm39) missense probably damaging 1.00
IGL02869:Lama2 APN 10 26,891,534 (GRCm39) missense probably damaging 0.99
IGL02942:Lama2 APN 10 26,917,216 (GRCm39) missense probably damaging 1.00
IGL03201:Lama2 APN 10 27,220,566 (GRCm39) nonsense probably null
IGL03268:Lama2 APN 10 27,298,649 (GRCm39) missense probably damaging 1.00
IGL03288:Lama2 APN 10 27,245,047 (GRCm39) missense probably damaging 1.00
IGL03380:Lama2 APN 10 26,926,261 (GRCm39) missense probably damaging 1.00
IGL03407:Lama2 APN 10 27,223,017 (GRCm39) missense probably damaging 1.00
cowboy UTSW 10 26,919,639 (GRCm39) frame shift probably null
petri UTSW 10 26,869,394 (GRCm39) splice site probably null
PIT4362001:Lama2 UTSW 10 27,245,132 (GRCm39) missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27,080,901 (GRCm39) missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 26,977,426 (GRCm39) missense probably damaging 1.00
R0038:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R0038:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R0114:Lama2 UTSW 10 26,869,064 (GRCm39) nonsense probably null
R0142:Lama2 UTSW 10 27,063,841 (GRCm39) missense probably benign
R0313:Lama2 UTSW 10 26,869,394 (GRCm39) splice site probably null
R0376:Lama2 UTSW 10 26,891,542 (GRCm39) missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27,066,621 (GRCm39) missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26,866,863 (GRCm39) missense probably damaging 1.00
R0607:Lama2 UTSW 10 27,065,127 (GRCm39) missense probably benign 0.34
R0648:Lama2 UTSW 10 26,865,372 (GRCm39) missense probably benign 0.00
R0667:Lama2 UTSW 10 27,220,406 (GRCm39) splice site probably null
R0760:Lama2 UTSW 10 26,920,429 (GRCm39) critical splice donor site probably null
R1240:Lama2 UTSW 10 26,917,120 (GRCm39) missense probably damaging 1.00
R1385:Lama2 UTSW 10 27,100,039 (GRCm39) missense probably benign 0.11
R1433:Lama2 UTSW 10 27,063,750 (GRCm39) missense probably damaging 1.00
R1434:Lama2 UTSW 10 27,084,366 (GRCm39) missense probably damaging 1.00
R1574:Lama2 UTSW 10 27,200,750 (GRCm39) missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27,200,750 (GRCm39) missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27,244,981 (GRCm39) missense probably damaging 1.00
R1702:Lama2 UTSW 10 27,066,525 (GRCm39) missense probably benign
R1703:Lama2 UTSW 10 27,142,667 (GRCm39) missense probably damaging 1.00
R1769:Lama2 UTSW 10 27,084,403 (GRCm39) missense probably benign
R1769:Lama2 UTSW 10 27,084,402 (GRCm39) missense probably damaging 1.00
R1846:Lama2 UTSW 10 27,088,092 (GRCm39) missense probably damaging 1.00
R1859:Lama2 UTSW 10 26,907,078 (GRCm39) missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26,860,490 (GRCm39) missense probably damaging 1.00
R1903:Lama2 UTSW 10 27,064,395 (GRCm39) missense probably damaging 1.00
R1906:Lama2 UTSW 10 26,932,523 (GRCm39) critical splice donor site probably null
R1958:Lama2 UTSW 10 26,857,594 (GRCm39) missense probably damaging 0.97
R1959:Lama2 UTSW 10 27,298,614 (GRCm39) missense probably damaging 1.00
R1977:Lama2 UTSW 10 26,866,796 (GRCm39) splice site probably null
R2063:Lama2 UTSW 10 27,040,922 (GRCm39) missense probably damaging 1.00
R2079:Lama2 UTSW 10 27,245,049 (GRCm39) missense probably damaging 0.99
R2085:Lama2 UTSW 10 27,080,837 (GRCm39) nonsense probably null
R2125:Lama2 UTSW 10 26,920,449 (GRCm39) nonsense probably null
R2140:Lama2 UTSW 10 26,930,690 (GRCm39) splice site probably null
R2219:Lama2 UTSW 10 26,919,565 (GRCm39) missense probably damaging 0.99
R2259:Lama2 UTSW 10 26,907,123 (GRCm39) missense probably benign 0.00
R2265:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2266:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R2267:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2268:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2269:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2862:Lama2 UTSW 10 27,298,608 (GRCm39) nonsense probably null
R2912:Lama2 UTSW 10 26,876,799 (GRCm39) missense probably benign
R2999:Lama2 UTSW 10 26,865,417 (GRCm39) missense probably benign 0.18
R3034:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3081:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3107:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3109:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3436:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3437:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3706:Lama2 UTSW 10 27,014,992 (GRCm39) missense probably damaging 1.00
R3780:Lama2 UTSW 10 27,335,335 (GRCm39) missense probably damaging 1.00
R3807:Lama2 UTSW 10 27,066,661 (GRCm39) frame shift probably null
R3919:Lama2 UTSW 10 26,994,501 (GRCm39) missense probably damaging 1.00
R4014:Lama2 UTSW 10 26,860,372 (GRCm39) missense probably damaging 1.00
R4131:Lama2 UTSW 10 26,917,170 (GRCm39) missense probably benign 0.00
R4190:Lama2 UTSW 10 27,142,660 (GRCm39) missense probably damaging 0.96
R4273:Lama2 UTSW 10 27,223,050 (GRCm39) missense probably damaging 1.00
R4358:Lama2 UTSW 10 26,860,489 (GRCm39) missense probably damaging 1.00
R4407:Lama2 UTSW 10 27,088,124 (GRCm39) small deletion probably benign
R4415:Lama2 UTSW 10 26,865,340 (GRCm39) nonsense probably null
R4426:Lama2 UTSW 10 27,298,554 (GRCm39) missense probably damaging 1.00
R4590:Lama2 UTSW 10 26,865,410 (GRCm39) missense probably benign 0.00
R4615:Lama2 UTSW 10 26,857,520 (GRCm39) missense probably damaging 0.99
R4736:Lama2 UTSW 10 27,080,925 (GRCm39) missense probably damaging 1.00
R4754:Lama2 UTSW 10 26,994,527 (GRCm39) missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27,343,267 (GRCm39) missense probably damaging 1.00
R4834:Lama2 UTSW 10 26,882,745 (GRCm39) missense probably benign 0.30
R4856:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4858:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4859:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4897:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4898:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4899:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4907:Lama2 UTSW 10 27,040,942 (GRCm39) missense probably benign 0.11
R4911:Lama2 UTSW 10 27,014,923 (GRCm39) missense probably damaging 1.00
R4924:Lama2 UTSW 10 27,245,137 (GRCm39) missense probably damaging 0.98
R5023:Lama2 UTSW 10 27,066,500 (GRCm39) missense probably damaging 0.97
R5057:Lama2 UTSW 10 27,040,982 (GRCm39) missense probably damaging 1.00
R5070:Lama2 UTSW 10 27,226,247 (GRCm39) critical splice donor site probably null
R5116:Lama2 UTSW 10 26,994,556 (GRCm39) missense probably benign 0.08
R5177:Lama2 UTSW 10 27,066,699 (GRCm39) missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27,222,999 (GRCm39) missense probably damaging 0.96
R5289:Lama2 UTSW 10 27,088,069 (GRCm39) nonsense probably null
R5327:Lama2 UTSW 10 27,014,942 (GRCm39) missense probably benign
R5424:Lama2 UTSW 10 26,860,392 (GRCm39) missense probably damaging 1.00
R5469:Lama2 UTSW 10 26,917,185 (GRCm39) missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26,866,876 (GRCm39) missense probably damaging 0.99
R5667:Lama2 UTSW 10 27,066,540 (GRCm39) missense probably damaging 1.00
R5671:Lama2 UTSW 10 27,066,540 (GRCm39) missense probably damaging 1.00
R5815:Lama2 UTSW 10 26,862,847 (GRCm39) missense probably damaging 1.00
R5917:Lama2 UTSW 10 27,066,693 (GRCm39) missense probably damaging 1.00
R5935:Lama2 UTSW 10 26,891,494 (GRCm39) missense probably benign
R5976:Lama2 UTSW 10 27,066,672 (GRCm39) missense probably benign 0.00
R5979:Lama2 UTSW 10 27,111,728 (GRCm39) missense probably damaging 0.99
R6004:Lama2 UTSW 10 27,111,781 (GRCm39) missense probably benign 0.01
R6180:Lama2 UTSW 10 26,857,495 (GRCm39) missense probably benign 0.03
R6198:Lama2 UTSW 10 27,064,018 (GRCm39) missense probably damaging 1.00
R6257:Lama2 UTSW 10 26,862,895 (GRCm39) missense possibly damaging 0.85
R6271:Lama2 UTSW 10 26,899,325 (GRCm39) missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27,066,543 (GRCm39) missense probably damaging 0.96
R6354:Lama2 UTSW 10 27,088,064 (GRCm39) missense probably damaging 1.00
R6431:Lama2 UTSW 10 26,929,027 (GRCm39) missense possibly damaging 0.50
R6499:Lama2 UTSW 10 26,907,154 (GRCm39) missense probably damaging 1.00
R6535:Lama2 UTSW 10 26,980,127 (GRCm39) missense probably damaging 1.00
R6545:Lama2 UTSW 10 27,052,793 (GRCm39) missense probably benign
R6636:Lama2 UTSW 10 27,000,564 (GRCm39) missense probably benign 0.13
R6891:Lama2 UTSW 10 27,204,078 (GRCm39) nonsense probably null
R6891:Lama2 UTSW 10 27,204,068 (GRCm39) nonsense probably null
R6902:Lama2 UTSW 10 26,857,625 (GRCm39) missense probably damaging 1.00
R6908:Lama2 UTSW 10 26,907,192 (GRCm39) splice site probably null
R7168:Lama2 UTSW 10 27,242,148 (GRCm39) critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27,107,659 (GRCm39) missense probably damaging 1.00
R7272:Lama2 UTSW 10 27,000,552 (GRCm39) missense probably damaging 1.00
R7274:Lama2 UTSW 10 26,995,976 (GRCm39) missense probably damaging 0.99
R7419:Lama2 UTSW 10 27,142,630 (GRCm39) missense probably benign
R7423:Lama2 UTSW 10 27,088,222 (GRCm39) missense probably benign 0.00
R7554:Lama2 UTSW 10 27,031,492 (GRCm39) missense probably damaging 1.00
R7569:Lama2 UTSW 10 27,141,046 (GRCm39) missense probably damaging 1.00
R7574:Lama2 UTSW 10 26,882,726 (GRCm39) missense probably benign 0.03
R7584:Lama2 UTSW 10 26,980,257 (GRCm39) missense possibly damaging 0.78
R7586:Lama2 UTSW 10 26,977,389 (GRCm39) missense probably benign 0.00
R7603:Lama2 UTSW 10 27,142,676 (GRCm39) missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27,084,389 (GRCm39) missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26,866,920 (GRCm39) missense probably damaging 0.97
R7841:Lama2 UTSW 10 27,031,529 (GRCm39) missense probably benign 0.00
R7864:Lama2 UTSW 10 26,932,611 (GRCm39) missense probably benign 0.08
R7960:Lama2 UTSW 10 26,869,094 (GRCm39) missense probably benign 0.04
R7964:Lama2 UTSW 10 27,099,977 (GRCm39) critical splice donor site probably null
R7980:Lama2 UTSW 10 27,239,609 (GRCm39) missense probably damaging 0.98
R8013:Lama2 UTSW 10 27,220,494 (GRCm39) missense probably benign 0.00
R8097:Lama2 UTSW 10 27,066,660 (GRCm39) nonsense probably null
R8100:Lama2 UTSW 10 26,917,113 (GRCm39) missense probably benign 0.03
R8110:Lama2 UTSW 10 26,866,866 (GRCm39) missense probably damaging 1.00
R8122:Lama2 UTSW 10 26,930,592 (GRCm39) missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27,343,218 (GRCm39) missense probably benign 0.07
R8315:Lama2 UTSW 10 27,298,655 (GRCm39) missense probably damaging 1.00
R8318:Lama2 UTSW 10 26,860,334 (GRCm39) missense probably damaging 1.00
R8419:Lama2 UTSW 10 27,298,559 (GRCm39) missense probably benign 0.26
R8475:Lama2 UTSW 10 26,977,369 (GRCm39) missense possibly damaging 0.69
R8735:Lama2 UTSW 10 27,066,530 (GRCm39) missense probably damaging 1.00
R8754:Lama2 UTSW 10 26,877,147 (GRCm39) missense possibly damaging 0.83
R8817:Lama2 UTSW 10 27,063,869 (GRCm39) missense probably damaging 1.00
R8851:Lama2 UTSW 10 27,242,119 (GRCm39) missense possibly damaging 0.94
R8859:Lama2 UTSW 10 27,335,384 (GRCm39) missense possibly damaging 0.58
R8886:Lama2 UTSW 10 27,245,157 (GRCm39) splice site probably benign
R8937:Lama2 UTSW 10 26,862,816 (GRCm39) missense probably damaging 1.00
R8993:Lama2 UTSW 10 27,298,710 (GRCm39) missense possibly damaging 0.91
R9025:Lama2 UTSW 10 26,860,367 (GRCm39) missense probably benign 0.00
R9027:Lama2 UTSW 10 27,080,881 (GRCm39) missense probably damaging 1.00
R9047:Lama2 UTSW 10 26,882,697 (GRCm39) missense possibly damaging 0.50
R9075:Lama2 UTSW 10 26,857,588 (GRCm39) missense probably damaging 1.00
R9135:Lama2 UTSW 10 27,298,515 (GRCm39) missense probably damaging 1.00
R9165:Lama2 UTSW 10 26,929,022 (GRCm39) critical splice donor site probably null
R9192:Lama2 UTSW 10 27,204,181 (GRCm39) missense possibly damaging 0.95
R9254:Lama2 UTSW 10 27,298,685 (GRCm39) missense probably damaging 0.96
R9326:Lama2 UTSW 10 26,906,193 (GRCm39) missense probably benign 0.04
R9356:Lama2 UTSW 10 27,088,186 (GRCm39) missense probably damaging 0.99
R9358:Lama2 UTSW 10 27,492,761 (GRCm39) missense unknown
R9358:Lama2 UTSW 10 27,064,378 (GRCm39) missense possibly damaging 0.95
R9376:Lama2 UTSW 10 26,994,620 (GRCm39) missense probably benign 0.11
R9381:Lama2 UTSW 10 27,064,023 (GRCm39) nonsense probably null
R9397:Lama2 UTSW 10 26,981,117 (GRCm39) missense probably benign 0.01
R9460:Lama2 UTSW 10 27,298,475 (GRCm39) missense probably damaging 1.00
R9478:Lama2 UTSW 10 26,891,478 (GRCm39) missense probably damaging 0.98
R9503:Lama2 UTSW 10 26,865,440 (GRCm39) missense possibly damaging 0.57
R9514:Lama2 UTSW 10 27,100,015 (GRCm39) missense probably benign 0.00
R9515:Lama2 UTSW 10 26,877,170 (GRCm39) missense probably benign 0.23
R9516:Lama2 UTSW 10 27,100,015 (GRCm39) missense probably benign 0.00
R9533:Lama2 UTSW 10 26,862,871 (GRCm39) missense probably damaging 1.00
R9619:Lama2 UTSW 10 27,064,282 (GRCm39) missense probably damaging 1.00
R9721:Lama2 UTSW 10 27,343,338 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TCCATGCACTTTCATGTTATCCAAG -3'
(R):5'- CAGGAAACCTTAGAGCTGCTATCTAC -3'

Sequencing Primer
(F):5'- CCAAGTTTAAGTTGTAACTAGGGTTG -3'
(R):5'- ACCTTAGAGCTGCTATCTACAATTAC -3'
Posted On 2020-06-30