Incidental Mutation 'R0717:Olfr177'
ID62887
Institutional Source Beutler Lab
Gene Symbol Olfr177
Ensembl Gene ENSMUSG00000063137
Gene Nameolfactory receptor 177
SynonymsGA_x54KRFPKG5P-55091371-55090442, MOR184-7
MMRRC Submission 038899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0717 (G1)
Quality Score132
Status Not validated
Chromosome16
Chromosomal Location58870955-58874768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58872770 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 127 (C127R)
Ref Sequence ENSEMBL: ENSMUSP00000150269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]
Predicted Effect probably damaging
Transcript: ENSMUST00000072853
AA Change: C127R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: C127R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 254 8.3e-6 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205920
AA Change: C127R
Predicted Effect probably damaging
Transcript: ENSMUST00000217377
AA Change: C127R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
Anxa11 G A 14: 25,874,789 probably null Het
Arhgap33 G T 7: 30,528,349 A475E probably damaging Het
Cacna1s A G 1: 136,098,291 N811S probably damaging Het
Cadm1 T A 9: 47,810,068 M252K probably benign Het
Cars T C 7: 143,584,755 R149G probably damaging Het
Ccdc125 A T 13: 100,690,358 D241V probably damaging Het
Col12a1 G A 9: 79,612,419 P2836S probably damaging Het
Grid2 T A 6: 64,666,275 I1007K possibly damaging Het
Hdhd2 G A 18: 76,951,204 A28T possibly damaging Het
Hivep1 A T 13: 42,154,946 T221S possibly damaging Het
Lztr1 A G 16: 17,516,048 probably null Het
Mbd1 C T 18: 74,273,597 A137V possibly damaging Het
Myh15 T C 16: 49,142,993 V1099A probably benign Het
Nox4 C A 7: 87,304,890 Y134* probably null Het
Pde1c T A 6: 56,123,012 N681I probably damaging Het
Pon1 A G 6: 5,193,674 probably null Het
Prokr2 T C 2: 132,381,334 D96G probably damaging Het
Sdk2 C A 11: 113,832,326 V1280F probably damaging Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Tcaf1 A T 6: 42,678,665 M459K probably benign Het
Tmem201 T A 4: 149,718,810 N534Y probably damaging Het
Tspan9 A T 6: 127,966,380 probably null Het
Uba7 A T 9: 107,977,217 T252S probably benign Het
Ube2e2 T C 14: 18,888,435 T3A probably benign Het
Other mutations in Olfr177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Olfr177 APN 16 58873036 missense probably damaging 1.00
IGL02223:Olfr177 APN 16 58872694 missense probably damaging 1.00
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0132:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0245:Olfr177 UTSW 16 58872866 missense probably benign 0.01
R0975:Olfr177 UTSW 16 58873150 splice site probably null
R1037:Olfr177 UTSW 16 58872970 missense probably damaging 1.00
R1256:Olfr177 UTSW 16 58872843 nonsense probably null
R1278:Olfr177 UTSW 16 58872977 missense probably damaging 1.00
R1538:Olfr177 UTSW 16 58872898 missense probably damaging 1.00
R1992:Olfr177 UTSW 16 58872511 missense probably benign 0.43
R2173:Olfr177 UTSW 16 58872619 missense probably damaging 0.99
R2392:Olfr177 UTSW 16 58872434 missense probably damaging 1.00
R5651:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5652:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5653:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R8031:Olfr177 UTSW 16 58872691 missense probably benign 0.03
R8108:Olfr177 UTSW 16 58872236 missense probably benign
R8531:Olfr177 UTSW 16 58872653 missense probably damaging 1.00
R8833:Olfr177 UTSW 16 58872596 missense probably damaging 0.99
V8831:Olfr177 UTSW 16 58873075 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGTGGGATGCACAAGTAGATAAGGCT -3'
(R):5'- GCCATCACACCCAAGATGCTAGAGAA -3'

Sequencing Primer
(F):5'- CATTGATATAAGGGTCAACACATGAG -3'
(R):5'- GAGTGCATGGCACAGTTCTA -3'
Posted On2013-07-30