Incidental Mutation 'R8028:Hif1a'
ID 628872
Institutional Source Beutler Lab
Gene Symbol Hif1a
Ensembl Gene ENSMUSG00000021109
Gene Name hypoxia inducible factor 1, alpha subunit
Synonyms bHLHe78, MOP1, HIF-1alpha, HIF1alpha
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 73948149-73994304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73988801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 589 (S589P)
Ref Sequence ENSEMBL: ENSMUSP00000021530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021530] [ENSMUST00000110461]
AlphaFold Q61221
Predicted Effect probably benign
Transcript: ENSMUST00000021530
AA Change: S589P

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021530
Gene: ENSMUSG00000021109
AA Change: S589P

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
PAS 230 296 2.08e-8 SMART
PAC 302 345 6.85e-9 SMART
low complexity region 416 427 N/A INTRINSIC
Pfam:HIF-1 564 594 5.4e-18 PFAM
low complexity region 621 645 N/A INTRINSIC
Pfam:HIF-1a_CTAD 799 835 3.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110461
AA Change: S563P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106088
Gene: ENSMUSG00000021109
AA Change: S563P

DomainStartEndE-ValueType
HLH 11 66 1.29e-8 SMART
PAS 75 141 1.05e-9 SMART
PAS 218 284 2.08e-8 SMART
PAC 290 333 6.85e-9 SMART
low complexity region 404 415 N/A INTRINSIC
Pfam:HIF-1 536 569 6e-19 PFAM
low complexity region 595 619 N/A INTRINSIC
Pfam:HIF-1a_CTAD 771 810 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit which, along with the beta subunit, forms a heterodimeric transcription factor that regulates the cellular and developmental response to reduced oxygen tension. The transcription factor has been shown to regulate genes involved in several biological processes, including erythropoiesis and angiogenesis which aid in increased delivery of oxygen to hypoxic regions. The transcription factor also plays a role in the induction of genes involved in cell proliferation and survival, energy metabolism, apoptosis, and glucose and iron metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die during embryonic development with severe cardiovascular malformations, neural tube defects, cephalic defects, reduced somite number and increased hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Hif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hif1a APN 12 73,988,784 (GRCm39) missense probably damaging 1.00
IGL01396:Hif1a APN 12 73,987,307 (GRCm39) missense probably benign 0.00
IGL02230:Hif1a APN 12 73,979,224 (GRCm39) missense probably damaging 1.00
IGL02561:Hif1a APN 12 73,988,980 (GRCm39) missense possibly damaging 0.52
IGL02698:Hif1a APN 12 73,977,545 (GRCm39) critical splice donor site probably null
IGL03027:Hif1a APN 12 73,987,251 (GRCm39) missense probably benign 0.03
lightweight UTSW 12 73,988,574 (GRCm39) missense probably damaging 1.00
R0597:Hif1a UTSW 12 73,989,049 (GRCm39) missense probably benign 0.00
R0614:Hif1a UTSW 12 73,992,405 (GRCm39) missense probably damaging 1.00
R0678:Hif1a UTSW 12 73,990,965 (GRCm39) splice site probably null
R0967:Hif1a UTSW 12 73,984,444 (GRCm39) missense possibly damaging 0.91
R1351:Hif1a UTSW 12 73,987,235 (GRCm39) missense probably benign 0.00
R1387:Hif1a UTSW 12 73,989,066 (GRCm39) missense possibly damaging 0.95
R1858:Hif1a UTSW 12 73,990,929 (GRCm39) missense probably benign
R2105:Hif1a UTSW 12 73,984,519 (GRCm39) missense probably damaging 1.00
R2194:Hif1a UTSW 12 73,977,521 (GRCm39) missense probably damaging 0.98
R4825:Hif1a UTSW 12 73,979,175 (GRCm39) missense probably damaging 1.00
R4924:Hif1a UTSW 12 73,986,331 (GRCm39) missense probably damaging 1.00
R5386:Hif1a UTSW 12 73,990,867 (GRCm39) missense probably benign 0.02
R5594:Hif1a UTSW 12 73,984,566 (GRCm39) nonsense probably null
R5722:Hif1a UTSW 12 73,988,533 (GRCm39) missense probably benign 0.00
R5818:Hif1a UTSW 12 73,986,338 (GRCm39) missense possibly damaging 0.64
R5831:Hif1a UTSW 12 73,988,918 (GRCm39) missense probably benign
R6026:Hif1a UTSW 12 73,979,055 (GRCm39) missense probably damaging 1.00
R6059:Hif1a UTSW 12 73,988,574 (GRCm39) missense probably damaging 1.00
R6084:Hif1a UTSW 12 73,988,616 (GRCm39) missense probably damaging 0.99
R6818:Hif1a UTSW 12 73,992,337 (GRCm39) nonsense probably null
R6878:Hif1a UTSW 12 73,975,055 (GRCm39) missense possibly damaging 0.49
R8286:Hif1a UTSW 12 73,992,022 (GRCm39) intron probably benign
R8322:Hif1a UTSW 12 73,986,373 (GRCm39) missense probably benign
R8414:Hif1a UTSW 12 73,984,428 (GRCm39) missense probably benign 0.00
R8729:Hif1a UTSW 12 73,990,902 (GRCm39) missense probably damaging 1.00
R9030:Hif1a UTSW 12 73,983,010 (GRCm39) missense probably damaging 1.00
R9087:Hif1a UTSW 12 73,989,099 (GRCm39) missense probably benign 0.01
R9093:Hif1a UTSW 12 73,979,111 (GRCm39) missense probably benign 0.12
R9300:Hif1a UTSW 12 73,987,302 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTCAGGTATGCTTATTACCTTGC -3'
(R):5'- TGCCACTGTATGCTGATGCC -3'

Sequencing Primer
(F):5'- ACCTTGCTTGTTTTGTACTTTAAGTG -3'
(R):5'- ACTGTATGCTGATGCCTTAGC -3'
Posted On 2020-06-30