Incidental Mutation 'R8028:Clcn2'
ID 628875
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms ClC-2, nmf240, Clc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20702964-20717746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20708762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 584 (Y584F)
Ref Sequence ENSEMBL: ENSMUSP00000007207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect possibly damaging
Transcript: ENSMUST00000007207
AA Change: Y584F

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: Y584F

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: Y567F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: Y567F

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect possibly damaging
Transcript: ENSMUST00000232309
AA Change: Y540F

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.2529 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G T 5: 31,487,922 V340F possibly damaging Het
Abca3 G A 17: 24,407,697 R1500Q probably benign Het
Arhgap21 C T 2: 20,880,405 V664M probably benign Het
Arhgef11 T C 3: 87,735,552 V1464A probably benign Het
Ccdc158 G T 5: 92,634,251 H836Q probably damaging Het
Csn1s2b G T 5: 87,819,092 M84I probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gimap4 A T 6: 48,690,750 R146S probably damaging Het
Gm20671 T C 5: 32,795,614 N184S possibly damaging Het
Gpr179 T C 11: 97,337,801 E1176G probably damaging Het
Hif1a T C 12: 73,942,027 S589P probably benign Het
Kcna7 T A 7: 45,409,523 C411* probably null Het
Kel C T 6: 41,699,024 S244N probably benign Het
Lama2 A T 10: 27,328,149 S498T probably benign Het
Map4 C T 9: 110,068,744 T846I probably damaging Het
Myh8 T C 11: 67,303,676 V1571A possibly damaging Het
Osbpl5 T C 7: 143,715,735 T47A probably benign Het
Parl T C 16: 20,280,051 K353E probably benign Het
Pcdhb17 G A 18: 37,487,449 S764N probably benign Het
Poglut1 A G 16: 38,534,733 S244P probably damaging Het
Polq C T 16: 37,061,316 H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,579,908 probably benign Het
Sardh C T 2: 27,230,455 M438I probably damaging Het
Slc14a1 T C 18: 78,116,512 I55M probably benign Het
Slc22a12 T A 19: 6,538,439 T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,302,498 probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk38l T C 6: 146,773,383 F382S probably damaging Het
Swt1 G T 1: 151,384,497 T717K probably benign Het
Tmem230 A G 2: 132,244,065 L59P probably benign Het
Vmn2r98 A T 17: 19,053,650 Y53F probably benign Het
Zscan12 C T 13: 21,368,852 S282L probably benign Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6663:Clcn2 UTSW 16 20703245 makesense probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R6825:Clcn2 UTSW 16 20709658 utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20713418 missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20712180 missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20712330 missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20712664 missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20707229 missense probably benign 0.00
R9456:Clcn2 UTSW 16 20715952 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGACAGAGGCTGCATACCTAAG -3'
(R):5'- TTGGCCTCTACTGACCCAAC -3'

Sequencing Primer
(F):5'- GAAAAGCCTCATTCTGGGCTC -3'
(R):5'- CCCAACCCAGGAGGAAGTTAG -3'
Posted On 2020-06-30