Incidental Mutation 'R8028:Clcn2'
ID 628875
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms nmf240, Clc2, ClC-2
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.584) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20521714-20536496 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20527512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 584 (Y584F)
Ref Sequence ENSEMBL: ENSMUSP00000007207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect possibly damaging
Transcript: ENSMUST00000007207
AA Change: Y584F

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: Y584F

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: Y567F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: Y567F

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect possibly damaging
Transcript: ENSMUST00000232309
AA Change: Y540F

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.2529 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Polq C T 16: 36,881,678 (GRCm39) H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20,522,391 (GRCm39) missense probably benign 0.08
IGL01657:Clcn2 APN 16 20,532,369 (GRCm39) missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20,531,511 (GRCm39) missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20,527,214 (GRCm39) missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20,522,098 (GRCm39) missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20,528,006 (GRCm39) nonsense probably null
IGL03329:Clcn2 APN 16 20,530,902 (GRCm39) missense probably damaging 1.00
Bemr14 UTSW 16 0 () unclassified
R0008:Clcn2 UTSW 16 20,529,140 (GRCm39) missense probably null 1.00
R0454:Clcn2 UTSW 16 20,529,178 (GRCm39) critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20,522,345 (GRCm39) missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20,531,302 (GRCm39) splice site probably benign
R1824:Clcn2 UTSW 16 20,534,712 (GRCm39) missense probably benign 0.04
R4592:Clcn2 UTSW 16 20,527,892 (GRCm39) missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20,522,053 (GRCm39) missense probably benign 0.01
R5374:Clcn2 UTSW 16 20,528,419 (GRCm39) missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20,529,285 (GRCm39) intron probably benign
R5787:Clcn2 UTSW 16 20,522,183 (GRCm39) missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20,532,404 (GRCm39) missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20,530,438 (GRCm39) critical splice donor site probably null
R6663:Clcn2 UTSW 16 20,521,995 (GRCm39) makesense probably null
R6765:Clcn2 UTSW 16 20,526,418 (GRCm39) splice site probably null
R6825:Clcn2 UTSW 16 20,528,408 (GRCm39) utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20,527,210 (GRCm39) missense probably damaging 0.99
R8198:Clcn2 UTSW 16 20,525,946 (GRCm39) missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20,532,168 (GRCm39) missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20,530,930 (GRCm39) missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20,531,080 (GRCm39) missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20,531,414 (GRCm39) missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20,525,979 (GRCm39) missense probably benign 0.00
R9456:Clcn2 UTSW 16 20,534,702 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGACAGAGGCTGCATACCTAAG -3'
(R):5'- TTGGCCTCTACTGACCCAAC -3'

Sequencing Primer
(F):5'- GAAAAGCCTCATTCTGGGCTC -3'
(R):5'- CCCAACCCAGGAGGAAGTTAG -3'
Posted On 2020-06-30