Incidental Mutation 'R8028:Polq'
ID 628876
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 067467-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.492) question?
Stock # R8028 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36832148-36915779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36881678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1281 (H1281Y)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect possibly damaging
Transcript: ENSMUST00000054034
AA Change: H1281Y

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: H1281Y

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000071452
AA Change: H1002Y

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: H1002Y

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,626,671 (GRCm39) R1500Q probably benign Het
Arhgap21 C T 2: 20,885,216 (GRCm39) V664M probably benign Het
Arhgef11 T C 3: 87,642,859 (GRCm39) V1464A probably benign Het
Ccdc121 G T 5: 31,645,266 (GRCm39) V340F possibly damaging Het
Ccdc158 G T 5: 92,782,110 (GRCm39) H836Q probably damaging Het
Clcn2 T A 16: 20,527,512 (GRCm39) Y584F possibly damaging Het
Csn1s2b G T 5: 87,966,951 (GRCm39) M84I probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gimap4 A T 6: 48,667,684 (GRCm39) R146S probably damaging Het
Gm20671 T C 5: 32,952,958 (GRCm39) N184S possibly damaging Het
Gpr179 T C 11: 97,228,627 (GRCm39) E1176G probably damaging Het
Hif1a T C 12: 73,988,801 (GRCm39) S589P probably benign Het
Kcna7 T A 7: 45,058,947 (GRCm39) C411* probably null Het
Kel C T 6: 41,675,958 (GRCm39) S244N probably benign Het
Lama2 A T 10: 27,204,145 (GRCm39) S498T probably benign Het
Map4 C T 9: 109,897,812 (GRCm39) T846I probably damaging Het
Myh8 T C 11: 67,194,502 (GRCm39) V1571A possibly damaging Het
Osbpl5 T C 7: 143,269,472 (GRCm39) T47A probably benign Het
Parl T C 16: 20,098,801 (GRCm39) K353E probably benign Het
Pcdhb17 G A 18: 37,620,502 (GRCm39) S764N probably benign Het
Poglut1 A G 16: 38,355,095 (GRCm39) S244P probably damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sardh C T 2: 27,120,467 (GRCm39) M438I probably damaging Het
Slc14a1 T C 18: 78,159,727 (GRCm39) I55M probably benign Het
Slc22a12 T A 19: 6,588,469 (GRCm39) T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,300,760 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk38l T C 6: 146,674,881 (GRCm39) F382S probably damaging Het
Swt1 G T 1: 151,260,248 (GRCm39) T717K probably benign Het
Tmem230 A G 2: 132,085,985 (GRCm39) L59P probably benign Het
Vmn2r98 A T 17: 19,273,912 (GRCm39) Y53F probably benign Het
Zscan12 C T 13: 21,553,022 (GRCm39) S282L probably benign Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 36,885,609 (GRCm39) splice site probably benign
IGL00539:Polq APN 16 36,880,931 (GRCm39) missense probably damaging 0.98
IGL00960:Polq APN 16 36,880,874 (GRCm39) missense probably damaging 0.96
IGL01100:Polq APN 16 36,881,474 (GRCm39) missense probably benign
IGL01112:Polq APN 16 36,837,671 (GRCm39) missense probably damaging 1.00
IGL01138:Polq APN 16 36,866,231 (GRCm39) missense possibly damaging 0.94
IGL01432:Polq APN 16 36,892,184 (GRCm39) splice site probably benign
IGL01522:Polq APN 16 36,848,265 (GRCm39) missense probably damaging 1.00
IGL01565:Polq APN 16 36,833,475 (GRCm39) missense probably benign 0.00
IGL01592:Polq APN 16 36,855,212 (GRCm39) missense probably benign 0.01
IGL01690:Polq APN 16 36,883,200 (GRCm39) missense probably damaging 0.97
IGL01943:Polq APN 16 36,881,805 (GRCm39) missense possibly damaging 0.47
IGL02531:Polq APN 16 36,882,736 (GRCm39) missense possibly damaging 0.75
IGL02553:Polq APN 16 36,862,130 (GRCm39) missense probably damaging 1.00
IGL02623:Polq APN 16 36,880,737 (GRCm39) missense probably benign 0.04
IGL02692:Polq APN 16 36,880,989 (GRCm39) missense probably damaging 1.00
IGL02717:Polq APN 16 36,843,102 (GRCm39) missense probably damaging 1.00
IGL02937:Polq APN 16 36,833,471 (GRCm39) missense probably benign 0.14
IGL02959:Polq APN 16 36,906,928 (GRCm39) missense probably damaging 1.00
IGL03086:Polq APN 16 36,911,411 (GRCm39) missense probably benign 0.02
IGL03141:Polq APN 16 36,837,720 (GRCm39) splice site probably benign
IGL03302:Polq APN 16 36,892,134 (GRCm39) missense probably damaging 1.00
IGL03393:Polq APN 16 36,865,156 (GRCm39) missense probably damaging 1.00
R0013_Polq_667 UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280_polq_867 UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
G1Funyon:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
PIT4403001:Polq UTSW 16 36,880,949 (GRCm39) missense probably benign 0.00
R0013:Polq UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R0082:Polq UTSW 16 36,837,619 (GRCm39) missense probably benign 0.01
R0212:Polq UTSW 16 36,887,216 (GRCm39) missense probably damaging 0.99
R0387:Polq UTSW 16 36,909,679 (GRCm39) missense probably damaging 1.00
R0387:Polq UTSW 16 36,849,792 (GRCm39) missense probably damaging 1.00
R0427:Polq UTSW 16 36,882,355 (GRCm39) nonsense probably null
R0454:Polq UTSW 16 36,855,252 (GRCm39) missense probably damaging 0.98
R0513:Polq UTSW 16 36,914,864 (GRCm39) missense probably damaging 1.00
R0622:Polq UTSW 16 36,881,355 (GRCm39) missense probably benign 0.02
R0848:Polq UTSW 16 36,882,492 (GRCm39) missense probably benign 0.08
R1142:Polq UTSW 16 36,833,579 (GRCm39) missense probably damaging 0.98
R1218:Polq UTSW 16 36,849,808 (GRCm39) missense possibly damaging 0.93
R1331:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R1398:Polq UTSW 16 36,882,857 (GRCm39) missense possibly damaging 0.87
R1424:Polq UTSW 16 36,906,890 (GRCm39) missense probably damaging 1.00
R1644:Polq UTSW 16 36,880,626 (GRCm39) missense probably damaging 0.96
R1777:Polq UTSW 16 36,880,586 (GRCm39) missense possibly damaging 0.94
R1820:Polq UTSW 16 36,849,780 (GRCm39) missense possibly damaging 0.48
R1854:Polq UTSW 16 36,882,471 (GRCm39) missense probably benign 0.01
R1880:Polq UTSW 16 36,906,954 (GRCm39) missense possibly damaging 0.90
R1932:Polq UTSW 16 36,882,666 (GRCm39) missense possibly damaging 0.92
R2008:Polq UTSW 16 36,882,844 (GRCm39) missense probably damaging 0.96
R2014:Polq UTSW 16 36,898,728 (GRCm39) missense probably damaging 1.00
R2026:Polq UTSW 16 36,883,107 (GRCm39) missense possibly damaging 0.93
R2178:Polq UTSW 16 36,883,191 (GRCm39) missense probably damaging 1.00
R2259:Polq UTSW 16 36,882,459 (GRCm39) missense probably benign 0.03
R2266:Polq UTSW 16 36,882,515 (GRCm39) missense possibly damaging 0.59
R2305:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R2370:Polq UTSW 16 36,894,301 (GRCm39) missense probably damaging 1.00
R2504:Polq UTSW 16 36,832,304 (GRCm39) missense unknown
R2517:Polq UTSW 16 36,909,687 (GRCm39) missense probably damaging 1.00
R2697:Polq UTSW 16 36,862,515 (GRCm39) missense probably damaging 1.00
R2858:Polq UTSW 16 36,883,115 (GRCm39) missense possibly damaging 0.88
R3436:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3437:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3699:Polq UTSW 16 36,862,518 (GRCm39) missense probably damaging 1.00
R3838:Polq UTSW 16 36,898,711 (GRCm39) missense probably damaging 1.00
R3875:Polq UTSW 16 36,894,389 (GRCm39) missense probably damaging 0.99
R4050:Polq UTSW 16 36,913,182 (GRCm39) critical splice acceptor site probably null
R4172:Polq UTSW 16 36,881,120 (GRCm39) missense probably benign 0.02
R4238:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4240:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280:Polq UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
R4296:Polq UTSW 16 36,881,663 (GRCm39) missense possibly damaging 0.94
R4360:Polq UTSW 16 36,880,701 (GRCm39) missense probably benign 0.00
R4373:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4375:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4376:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4509:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4510:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4511:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4543:Polq UTSW 16 36,881,147 (GRCm39) missense probably benign 0.43
R4633:Polq UTSW 16 36,868,904 (GRCm39) missense probably damaging 1.00
R4739:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R4834:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 1.00
R4841:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4842:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4937:Polq UTSW 16 36,848,274 (GRCm39) missense probably benign 0.01
R4955:Polq UTSW 16 36,881,444 (GRCm39) missense probably benign 0.32
R4992:Polq UTSW 16 36,881,524 (GRCm39) missense possibly damaging 0.59
R5008:Polq UTSW 16 36,882,749 (GRCm39) missense probably benign
R5221:Polq UTSW 16 36,862,540 (GRCm39) missense probably damaging 0.98
R5254:Polq UTSW 16 36,909,681 (GRCm39) missense probably damaging 1.00
R5292:Polq UTSW 16 36,881,745 (GRCm39) missense probably damaging 1.00
R5375:Polq UTSW 16 36,903,146 (GRCm39) missense probably damaging 1.00
R5480:Polq UTSW 16 36,833,652 (GRCm39) splice site probably benign
R5552:Polq UTSW 16 36,914,872 (GRCm39) missense possibly damaging 0.93
R5591:Polq UTSW 16 36,832,247 (GRCm39) utr 5 prime probably benign
R5653:Polq UTSW 16 36,860,896 (GRCm39) missense probably damaging 1.00
R5708:Polq UTSW 16 36,881,380 (GRCm39) missense probably damaging 0.98
R5754:Polq UTSW 16 36,837,625 (GRCm39) missense probably benign
R5757:Polq UTSW 16 36,907,043 (GRCm39) missense probably benign 0.01
R5764:Polq UTSW 16 36,837,706 (GRCm39) missense probably damaging 0.97
R6019:Polq UTSW 16 36,882,126 (GRCm39) missense probably damaging 1.00
R6170:Polq UTSW 16 36,866,174 (GRCm39) missense possibly damaging 0.82
R6177:Polq UTSW 16 36,892,071 (GRCm39) missense probably damaging 0.98
R6307:Polq UTSW 16 36,837,718 (GRCm39) critical splice donor site probably null
R6499:Polq UTSW 16 36,881,189 (GRCm39) missense probably benign 0.03
R6520:Polq UTSW 16 36,880,739 (GRCm39) missense possibly damaging 0.88
R6598:Polq UTSW 16 36,881,993 (GRCm39) missense probably benign 0.39
R6694:Polq UTSW 16 36,835,535 (GRCm39) missense probably null 0.99
R6788:Polq UTSW 16 36,897,510 (GRCm39) missense probably damaging 1.00
R7104:Polq UTSW 16 36,909,715 (GRCm39) nonsense probably null
R7159:Polq UTSW 16 36,883,215 (GRCm39) missense possibly damaging 0.87
R7222:Polq UTSW 16 36,906,995 (GRCm39) nonsense probably null
R7340:Polq UTSW 16 36,881,288 (GRCm39) missense probably benign 0.00
R7361:Polq UTSW 16 36,880,790 (GRCm39) missense probably benign 0.00
R7384:Polq UTSW 16 36,849,780 (GRCm39) missense probably damaging 1.00
R7509:Polq UTSW 16 36,880,706 (GRCm39) missense probably benign 0.00
R7509:Polq UTSW 16 36,880,705 (GRCm39) missense probably benign
R7575:Polq UTSW 16 36,911,496 (GRCm39) missense probably benign 0.00
R7785:Polq UTSW 16 36,848,239 (GRCm39) missense probably damaging 1.00
R7787:Polq UTSW 16 36,837,671 (GRCm39) missense probably damaging 1.00
R7891:Polq UTSW 16 36,848,244 (GRCm39) missense probably damaging 1.00
R7898:Polq UTSW 16 36,865,245 (GRCm39) missense probably damaging 0.98
R7917:Polq UTSW 16 36,885,650 (GRCm39) missense probably benign 0.08
R7940:Polq UTSW 16 36,881,004 (GRCm39) missense probably benign 0.27
R8114:Polq UTSW 16 36,862,577 (GRCm39) missense possibly damaging 0.94
R8144:Polq UTSW 16 36,849,846 (GRCm39) missense probably benign 0.01
R8288:Polq UTSW 16 36,848,272 (GRCm39) missense probably damaging 1.00
R8301:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
R8341:Polq UTSW 16 36,892,133 (GRCm39) missense possibly damaging 0.96
R8348:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8448:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8815:Polq UTSW 16 36,853,893 (GRCm39) missense probably damaging 1.00
R8843:Polq UTSW 16 36,832,280 (GRCm39) missense unknown
R8878:Polq UTSW 16 36,860,869 (GRCm39) missense probably benign 0.02
R9016:Polq UTSW 16 36,843,159 (GRCm39) missense probably damaging 1.00
R9189:Polq UTSW 16 36,865,265 (GRCm39) missense probably damaging 1.00
R9209:Polq UTSW 16 36,869,011 (GRCm39) missense possibly damaging 0.94
R9352:Polq UTSW 16 36,862,252 (GRCm39) missense probably damaging 0.98
R9398:Polq UTSW 16 36,881,394 (GRCm39) missense probably benign 0.02
R9403:Polq UTSW 16 36,882,215 (GRCm39) missense probably benign 0.00
R9489:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9605:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9664:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 0.98
R9801:Polq UTSW 16 36,913,190 (GRCm39) missense probably damaging 1.00
X0060:Polq UTSW 16 36,837,599 (GRCm39) nonsense probably null
Z1176:Polq UTSW 16 36,862,619 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGACTCAAATGATGCTGCACC -3'
(R):5'- CTGGAGTGCTGTGACACTTG -3'

Sequencing Primer
(F):5'- TGATGCTGCACCCATCAAATGTG -3'
(R):5'- ACACTTGTTCTGCATGGCG -3'
Posted On 2020-06-30