Incidental Mutation 'R8028:Sry'
ID 628883
Institutional Source Beutler Lab
Gene Symbol Sry
Ensembl Gene ENSMUSG00000069036
Gene Name sex determining region of Chr Y
Synonyms Tdy, Tdf
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R8028 (G1)
Quality Score 197.459
Status Not validated
Chromosome Y
Chromosomal Location 2662471-2663658 bp(-) (GRCm38)
Type of Mutation small deletion (10 aa in frame mutation)
DNA Base Change (assembly) GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG at 2662638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091178]
AlphaFold Q05738
Predicted Effect probably benign
Transcript: ENSMUST00000091178
SMART Domains Protein: ENSMUSP00000088717
Gene: ENSMUSG00000069036

DomainStartEndE-ValueType
HMG 4 74 2.76e-24 SMART
low complexity region 144 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.4%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Variations in expression of alleles on specific backgrounds result in partial and/or complete male to female sex reversal. Deletion of alleles results in XY females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G T 5: 31,487,922 V340F possibly damaging Het
Abca3 G A 17: 24,407,697 R1500Q probably benign Het
Arhgap21 C T 2: 20,880,405 V664M probably benign Het
Arhgef11 T C 3: 87,735,552 V1464A probably benign Het
Ccdc158 G T 5: 92,634,251 H836Q probably damaging Het
Clcn2 T A 16: 20,708,762 Y584F possibly damaging Het
Csn1s2b G T 5: 87,819,092 M84I probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gimap4 A T 6: 48,690,750 R146S probably damaging Het
Gm20671 T C 5: 32,795,614 N184S possibly damaging Het
Gpr179 T C 11: 97,337,801 E1176G probably damaging Het
Hif1a T C 12: 73,942,027 S589P probably benign Het
Kcna7 T A 7: 45,409,523 C411* probably null Het
Kel C T 6: 41,699,024 S244N probably benign Het
Lama2 A T 10: 27,328,149 S498T probably benign Het
Map4 C T 9: 110,068,744 T846I probably damaging Het
Myh8 T C 11: 67,303,676 V1571A possibly damaging Het
Osbpl5 T C 7: 143,715,735 T47A probably benign Het
Parl T C 16: 20,280,051 K353E probably benign Het
Pcdhb17 G A 18: 37,487,449 S764N probably benign Het
Poglut1 A G 16: 38,534,733 S244P probably damaging Het
Polq C T 16: 37,061,316 H1281Y possibly damaging Het
Rsf1 CG CGACCGCGGGG 7: 97,579,908 probably benign Het
Sardh C T 2: 27,230,455 M438I probably damaging Het
Slc14a1 T C 18: 78,116,512 I55M probably benign Het
Slc22a12 T A 19: 6,538,439 T350S probably benign Het
Srrt CACCTTCTCCCCAGAACCCCACACCTTACCTG C 5: 137,302,498 probably benign Het
Stk38l T C 6: 146,773,383 F382S probably damaging Het
Swt1 G T 1: 151,384,497 T717K probably benign Het
Tmem230 A G 2: 132,244,065 L59P probably benign Het
Vmn2r98 A T 17: 19,053,650 Y53F probably benign Het
Zscan12 C T 13: 21,368,852 S282L probably benign Het
Other mutations in Sry
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Sry UTSW Y 2662837 small insertion probably benign
FR4340:Sry UTSW Y 2662824 small insertion probably benign
FR4342:Sry UTSW Y 2662835 small insertion probably benign
FR4342:Sry UTSW Y 2662836 small insertion probably benign
FR4342:Sry UTSW Y 2662839 small insertion probably benign
FR4342:Sry UTSW Y 2663146 small deletion probably benign
FR4449:Sry UTSW Y 2662818 small insertion probably benign
FR4449:Sry UTSW Y 2662832 small insertion probably benign
FR4589:Sry UTSW Y 2662818 small insertion probably benign
FR4737:Sry UTSW Y 2662837 small insertion probably benign
FR4737:Sry UTSW Y 2662838 small insertion probably benign
FR4737:Sry UTSW Y 2663195 small deletion probably benign
FR4976:Sry UTSW Y 2662841 small insertion probably benign
R0288:Sry UTSW Y 2662818 missense unknown
R0506:Sry UTSW Y 2662864 missense unknown
R0690:Sry UTSW Y 2662944 small deletion probably benign
R0784:Sry UTSW Y 2662731 missense unknown
R1373:Sry UTSW Y 2662864 missense unknown
R1555:Sry UTSW Y 2662975 missense unknown
R1638:Sry UTSW Y 2663149 missense unknown
R2110:Sry UTSW Y 2662901 missense unknown
R2212:Sry UTSW Y 2663339 missense probably damaging 0.99
R3150:Sry UTSW Y 2662944 small deletion probably benign
R3552:Sry UTSW Y 2663141 missense unknown
R4877:Sry UTSW Y 2662864 missense unknown
R4888:Sry UTSW Y 2663105 missense unknown
R5028:Sry UTSW Y 2663312 missense probably damaging 0.97
R5266:Sry UTSW Y 2662975 missense unknown
R5305:Sry UTSW Y 2662982 missense unknown
R5335:Sry UTSW Y 2663647 missense probably benign 0.08
R5587:Sry UTSW Y 2662625 missense unknown
R5915:Sry UTSW Y 2662612 missense unknown
R6183:Sry UTSW Y 2662975 missense unknown
R6184:Sry UTSW Y 2662975 missense unknown
R6187:Sry UTSW Y 2662975 missense unknown
R6976:Sry UTSW Y 2662938 missense unknown
R7358:Sry UTSW Y 2662638 small deletion probably benign
R7632:Sry UTSW Y 2662638 small deletion probably benign
R7678:Sry UTSW Y 2663248 missense possibly damaging 0.83
R7737:Sry UTSW Y 2662638 small deletion probably benign
R7812:Sry UTSW Y 2662638 small deletion probably benign
R7829:Sry UTSW Y 2662638 small deletion probably benign
R8005:Sry UTSW Y 2663303 missense possibly damaging 0.88
R8082:Sry UTSW Y 2662589 missense unknown
R8212:Sry UTSW Y 2662638 small deletion probably benign
R8223:Sry UTSW Y 2663204 missense unknown
R8252:Sry UTSW Y 2663298 missense possibly damaging 0.91
R8390:Sry UTSW Y 2662638 small deletion probably benign
R9027:Sry UTSW Y 2662638 small deletion probably benign
R9429:Sry UTSW Y 2662638 small deletion probably benign
RF002:Sry UTSW Y 2662564 small deletion probably benign
RF006:Sry UTSW Y 2662638 small deletion probably benign
RF008:Sry UTSW Y 2662826 small insertion probably benign
RF040:Sry UTSW Y 2662590 small insertion probably benign
RF063:Sry UTSW Y 2662595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGTCATGAGACTGCCAACCAC -3'
(R):5'- CCTGTTGATATCCCCACTGG -3'

Sequencing Primer
(F):5'- ACAGGGCTGTGCTGAGG -3'
(R):5'- GCAGCAGCATCAGTTCCATG -3'
Posted On 2020-06-30