Incidental Mutation 'R8071:Erbb4'
ID628887
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8071 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68396311 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 142 (I142M)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: I142M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: I142M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: I142M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: I142M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153432
AA Change: I142M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: I142M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,623,929 E963* probably null Het
Acads T C 5: 115,113,167 E86G probably benign Het
Agmo A G 12: 37,398,729 T217A probably damaging Het
Arhgap39 A G 15: 76,737,502 S300P probably benign Het
Casp12 T C 9: 5,346,647 L58P probably damaging Het
Ccar2 T C 14: 70,152,453 T24A probably benign Het
Ccndbp1 C A 2: 121,014,565 T321K unknown Het
Cd200r3 G A 16: 44,954,140 C172Y probably damaging Het
Chd2 T A 7: 73,537,384 H9L probably benign Het
Cramp1l T A 17: 24,982,700 S603C probably damaging Het
Crtac1 C T 19: 42,297,800 R448H probably damaging Het
Csmd2 A T 4: 128,393,538 Y1022F Het
Ctns T C 11: 73,184,934 Y363C probably damaging Het
D630044L22Rik A G 17: 25,960,144 T15A possibly damaging Het
Dhx38 A C 8: 109,558,701 I444M probably benign Het
Dnah14 A T 1: 181,615,894 I450F possibly damaging Het
Dpf1 T C 7: 29,314,141 F245L probably benign Het
Efr3b A G 12: 3,982,898 V269A probably benign Het
Eprs G T 1: 185,394,456 V530L possibly damaging Het
Eps8l2 A G 7: 141,342,947 N41S probably damaging Het
Fam160a1 T C 3: 85,730,561 M144V probably damaging Het
Flnc A T 6: 29,457,446 D2381V probably damaging Het
Fndc1 T A 17: 7,772,530 D778V unknown Het
Galnt3 A G 2: 66,091,211 I492T probably benign Het
Gigyf2 T C 1: 87,446,433 M1261T probably damaging Het
Haus8 A G 8: 71,256,051 F126S probably benign Het
Hif3a A G 7: 17,048,761 L293S probably damaging Het
Ino80c G A 18: 24,106,650 T200I unknown Het
Jag1 T A 2: 137,101,797 M160L probably benign Het
Kcnj12 C A 11: 61,069,999 H374Q probably damaging Het
Lrrc27 A G 7: 139,236,986 I433M probably benign Het
Lyzl4 C T 9: 121,578,094 W123* probably null Het
Map2k4 A T 11: 65,707,001 C264S Het
Mmrn1 C T 6: 60,944,524 probably benign Het
Mug1 C T 6: 121,873,672 T709I probably benign Het
Myo9a T A 9: 59,874,648 W1706R probably benign Het
Nlrp5 A G 7: 23,418,444 E531G probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Pcdhb11 A C 18: 37,422,369 I251L probably benign Het
Per3 A G 4: 151,028,813 S353P probably damaging Het
Piezo1 T C 8: 122,487,011 E1738G probably null Het
Prr14l T C 5: 32,831,164 D329G probably benign Het
Ptpn23 G T 9: 110,388,199 P863Q probably damaging Het
Ptpn23 G T 9: 110,388,200 P863T possibly damaging Het
Ptprq T C 10: 107,644,035 K1125E possibly damaging Het
Rapgef2 T G 3: 79,093,036 T351P probably damaging Het
Rbl2 A G 8: 91,113,989 Y923C probably damaging Het
Rimbp3 T C 16: 17,210,863 V717A probably benign Het
Rims1 C T 1: 22,288,536 W182* probably null Het
Rnmt A G 18: 68,307,652 K129E probably benign Het
Ruvbl1 T C 6: 88,473,126 F93S probably damaging Het
Scamp5 T C 9: 57,443,686 Y231C probably damaging Het
Sfxn5 T A 6: 85,267,939 probably null Het
Skiv2l A T 17: 34,849,999 V8D probably benign Het
Slc12a1 T C 2: 125,186,314 F510S probably damaging Het
Sowahb T C 5: 93,043,063 Y599C probably damaging Het
Speer4e T C 5: 14,937,097 N98S probably damaging Het
Stat3 T C 11: 100,893,981 N553S probably benign Het
Sult6b2 A T 6: 142,790,142 L242Q probably damaging Het
Tacc3 C T 5: 33,663,825 R98W possibly damaging Het
Tuba4a C T 1: 75,216,951 R112H Het
Ubr3 T A 2: 69,988,876 S1337T probably damaging Het
Vmn2r69 A T 7: 85,406,505 C808* probably null Het
Wnt16 G A 6: 22,288,998 A105T probably benign Het
Zfp692 C T 11: 58,307,734 S50L probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTGGCATGCTGAACAAGTTG -3'
(R):5'- CCCATTCATGGTAAAGTTACAGAAAC -3'

Sequencing Primer
(F):5'- CCATTCCCTATATGCTGGATGAAGAG -3'
(R):5'- TGGTTTAATCTGTACTTTTCAACCTC -3'
Posted On2020-06-30