Incidental Mutation 'R8071:Galnt3'
ID 628892
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Name polypeptide N-acetylgalactosaminyltransferase 3
Synonyms ppGaNTase-T3
MMRRC Submission 067506-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.380) question?
Stock # R8071 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65913110-65955217 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65921555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 492 (I492T)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
AlphaFold P70419
Predicted Effect probably benign
Transcript: ENSMUST00000028378
AA Change: I492T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: I492T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads T C 5: 115,251,226 (GRCm39) E86G probably benign Het
Agmo A G 12: 37,448,728 (GRCm39) T217A probably damaging Het
Arhgap39 A G 15: 76,621,702 (GRCm39) S300P probably benign Het
Casp12 T C 9: 5,346,647 (GRCm39) L58P probably damaging Het
Ccar2 T C 14: 70,389,902 (GRCm39) T24A probably benign Het
Ccndbp1 C A 2: 120,845,046 (GRCm39) T321K unknown Het
Cd200r3 G A 16: 44,774,503 (GRCm39) C172Y probably damaging Het
Chd2 T A 7: 73,187,132 (GRCm39) H9L probably benign Het
Cracdl C A 1: 37,663,010 (GRCm39) E963* probably null Het
Cramp1 T A 17: 25,201,674 (GRCm39) S603C probably damaging Het
Crtac1 C T 19: 42,286,239 (GRCm39) R448H probably damaging Het
Csmd2 A T 4: 128,287,331 (GRCm39) Y1022F Het
Ctns T C 11: 73,075,760 (GRCm39) Y363C probably damaging Het
D630044L22Rik A G 17: 26,179,118 (GRCm39) T15A possibly damaging Het
Dhx38 A C 8: 110,285,333 (GRCm39) I444M probably benign Het
Dnah14 A T 1: 181,443,459 (GRCm39) I450F possibly damaging Het
Dpf1 T C 7: 29,013,566 (GRCm39) F245L probably benign Het
Efr3b A G 12: 4,032,898 (GRCm39) V269A probably benign Het
Eprs1 G T 1: 185,126,653 (GRCm39) V530L possibly damaging Het
Eps8l2 A G 7: 140,922,860 (GRCm39) N41S probably damaging Het
Erbb4 T C 1: 68,435,470 (GRCm39) I142M probably damaging Het
Fhip1a T C 3: 85,637,868 (GRCm39) M144V probably damaging Het
Flnc A T 6: 29,457,445 (GRCm39) D2381V probably damaging Het
Fndc1 T A 17: 7,991,362 (GRCm39) D778V unknown Het
Gigyf2 T C 1: 87,374,155 (GRCm39) M1261T probably damaging Het
Haus8 A G 8: 71,708,695 (GRCm39) F126S probably benign Het
Hif3a A G 7: 16,782,686 (GRCm39) L293S probably damaging Het
Ino80c G A 18: 24,239,707 (GRCm39) T200I unknown Het
Jag1 T A 2: 136,943,717 (GRCm39) M160L probably benign Het
Kcnj12 C A 11: 60,960,825 (GRCm39) H374Q probably damaging Het
Lrrc27 A G 7: 138,816,902 (GRCm39) I433M probably benign Het
Lyzl4 C T 9: 121,407,160 (GRCm39) W123* probably null Het
Map2k4 A T 11: 65,597,827 (GRCm39) C264S Het
Mmrn1 C T 6: 60,921,508 (GRCm39) probably benign Het
Mug1 C T 6: 121,850,631 (GRCm39) T709I probably benign Het
Myo9a T A 9: 59,781,931 (GRCm39) W1706R probably benign Het
Nlrp5 A G 7: 23,117,869 (GRCm39) E531G probably damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Pcdhb11 A C 18: 37,555,422 (GRCm39) I251L probably benign Het
Per3 A G 4: 151,113,270 (GRCm39) S353P probably damaging Het
Piezo1 T C 8: 123,213,750 (GRCm39) E1738G probably null Het
Prr14l T C 5: 32,988,508 (GRCm39) D329G probably benign Het
Ptpn23 G T 9: 110,217,267 (GRCm39) P863Q probably damaging Het
Ptpn23 G T 9: 110,217,268 (GRCm39) P863T possibly damaging Het
Ptprq T C 10: 107,479,896 (GRCm39) K1125E possibly damaging Het
Rapgef2 T G 3: 79,000,343 (GRCm39) T351P probably damaging Het
Rbl2 A G 8: 91,840,617 (GRCm39) Y923C probably damaging Het
Rimbp3 T C 16: 17,028,727 (GRCm39) V717A probably benign Het
Rims1 C T 1: 22,358,760 (GRCm39) W182* probably null Het
Rnmt A G 18: 68,440,723 (GRCm39) K129E probably benign Het
Ruvbl1 T C 6: 88,450,108 (GRCm39) F93S probably damaging Het
Scamp5 T C 9: 57,350,969 (GRCm39) Y231C probably damaging Het
Sfxn5 T A 6: 85,244,921 (GRCm39) probably null Het
Skic2 A T 17: 35,068,975 (GRCm39) V8D probably benign Het
Slc12a1 T C 2: 125,028,234 (GRCm39) F510S probably damaging Het
Sowahb T C 5: 93,190,922 (GRCm39) Y599C probably damaging Het
Speer4e1 T C 5: 14,987,111 (GRCm39) N98S probably damaging Het
Stat3 T C 11: 100,784,807 (GRCm39) N553S probably benign Het
Sult6b2 A T 6: 142,735,868 (GRCm39) L242Q probably damaging Het
Tacc3 C T 5: 33,821,169 (GRCm39) R98W possibly damaging Het
Tuba4a C T 1: 75,193,595 (GRCm39) R112H Het
Ubr3 T A 2: 69,819,220 (GRCm39) S1337T probably damaging Het
Vmn2r69 A T 7: 85,055,713 (GRCm39) C808* probably null Het
Wnt16 G A 6: 22,288,997 (GRCm39) A105T probably benign Het
Zfp692 C T 11: 58,198,560 (GRCm39) S50L probably damaging Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 65,925,628 (GRCm39) missense probably damaging 1.00
IGL01563:Galnt3 APN 2 65,928,101 (GRCm39) missense probably damaging 0.97
IGL01973:Galnt3 APN 2 65,914,606 (GRCm39) missense probably benign 0.03
IGL02004:Galnt3 APN 2 65,926,270 (GRCm39) missense probably damaging 1.00
IGL02424:Galnt3 APN 2 65,926,132 (GRCm39) critical splice donor site probably null
IGL02946:Galnt3 APN 2 65,925,562 (GRCm39) missense probably damaging 0.99
IGL03059:Galnt3 APN 2 65,923,954 (GRCm39) missense probably damaging 1.00
PIT4531001:Galnt3 UTSW 2 65,937,432 (GRCm39) missense probably benign 0.03
R0437:Galnt3 UTSW 2 65,937,573 (GRCm39) missense possibly damaging 0.74
R1390:Galnt3 UTSW 2 65,921,567 (GRCm39) missense probably damaging 1.00
R1536:Galnt3 UTSW 2 65,914,550 (GRCm39) missense probably damaging 1.00
R1869:Galnt3 UTSW 2 65,928,123 (GRCm39) missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 65,914,585 (GRCm39) missense probably benign 0.00
R3973:Galnt3 UTSW 2 65,937,374 (GRCm39) missense possibly damaging 0.77
R4039:Galnt3 UTSW 2 65,915,671 (GRCm39) missense probably damaging 0.96
R4515:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4518:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4519:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4577:Galnt3 UTSW 2 65,928,203 (GRCm39) missense probably benign 0.02
R4817:Galnt3 UTSW 2 65,923,883 (GRCm39) missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 65,915,585 (GRCm39) missense probably benign 0.04
R5191:Galnt3 UTSW 2 65,924,050 (GRCm39) missense probably damaging 1.00
R5947:Galnt3 UTSW 2 65,914,500 (GRCm39) utr 3 prime probably benign
R6534:Galnt3 UTSW 2 65,932,875 (GRCm39) missense probably damaging 1.00
R7196:Galnt3 UTSW 2 65,921,268 (GRCm39) missense probably damaging 1.00
R7817:Galnt3 UTSW 2 65,926,243 (GRCm39) missense probably damaging 1.00
R7951:Galnt3 UTSW 2 65,928,186 (GRCm39) missense probably benign 0.00
R7952:Galnt3 UTSW 2 65,928,186 (GRCm39) missense probably benign 0.00
R8513:Galnt3 UTSW 2 65,924,064 (GRCm39) nonsense probably null
R8844:Galnt3 UTSW 2 65,915,636 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTGACCCACACTCTTAATC -3'
(R):5'- CCTGTGGCTTACATGAATGGC -3'

Sequencing Primer
(F):5'- GTTGACCCACACTCTTAATCTAAATG -3'
(R):5'- TGGCATTTGAAGTCCATCCAG -3'
Posted On 2020-06-30