Incidental Mutation 'R8071:Csmd2'
ID628899
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8071 (G1)
Quality Score206.009
Status Not validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128393538 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1022 (Y1022F)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,623,929 E963* probably null Het
Acads T C 5: 115,113,167 E86G probably benign Het
Agmo A G 12: 37,398,729 T217A probably damaging Het
Arhgap39 A G 15: 76,737,502 S300P probably benign Het
Casp12 T C 9: 5,346,647 L58P probably damaging Het
Ccar2 T C 14: 70,152,453 T24A probably benign Het
Ccndbp1 C A 2: 121,014,565 T321K unknown Het
Cd200r3 G A 16: 44,954,140 C172Y probably damaging Het
Chd2 T A 7: 73,537,384 H9L probably benign Het
Cramp1l T A 17: 24,982,700 S603C probably damaging Het
Crtac1 C T 19: 42,297,800 R448H probably damaging Het
Ctns T C 11: 73,184,934 Y363C probably damaging Het
D630044L22Rik A G 17: 25,960,144 T15A possibly damaging Het
Dhx38 A C 8: 109,558,701 I444M probably benign Het
Dnah14 A T 1: 181,615,894 I450F possibly damaging Het
Dpf1 T C 7: 29,314,141 F245L probably benign Het
Efr3b A G 12: 3,982,898 V269A probably benign Het
Eprs G T 1: 185,394,456 V530L possibly damaging Het
Eps8l2 A G 7: 141,342,947 N41S probably damaging Het
Erbb4 T C 1: 68,396,311 I142M probably damaging Het
Fam160a1 T C 3: 85,730,561 M144V probably damaging Het
Flnc A T 6: 29,457,446 D2381V probably damaging Het
Fndc1 T A 17: 7,772,530 D778V unknown Het
Galnt3 A G 2: 66,091,211 I492T probably benign Het
Gigyf2 T C 1: 87,446,433 M1261T probably damaging Het
Haus8 A G 8: 71,256,051 F126S probably benign Het
Hif3a A G 7: 17,048,761 L293S probably damaging Het
Ino80c G A 18: 24,106,650 T200I unknown Het
Jag1 T A 2: 137,101,797 M160L probably benign Het
Kcnj12 C A 11: 61,069,999 H374Q probably damaging Het
Lrrc27 A G 7: 139,236,986 I433M probably benign Het
Lyzl4 C T 9: 121,578,094 W123* probably null Het
Map2k4 A T 11: 65,707,001 C264S Het
Mmrn1 C T 6: 60,944,524 probably benign Het
Mug1 C T 6: 121,873,672 T709I probably benign Het
Myo9a T A 9: 59,874,648 W1706R probably benign Het
Nlrp5 A G 7: 23,418,444 E531G probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Pcdhb11 A C 18: 37,422,369 I251L probably benign Het
Per3 A G 4: 151,028,813 S353P probably damaging Het
Piezo1 T C 8: 122,487,011 E1738G probably null Het
Prr14l T C 5: 32,831,164 D329G probably benign Het
Ptpn23 G T 9: 110,388,199 P863Q probably damaging Het
Ptpn23 G T 9: 110,388,200 P863T possibly damaging Het
Ptprq T C 10: 107,644,035 K1125E possibly damaging Het
Rapgef2 T G 3: 79,093,036 T351P probably damaging Het
Rbl2 A G 8: 91,113,989 Y923C probably damaging Het
Rimbp3 T C 16: 17,210,863 V717A probably benign Het
Rims1 C T 1: 22,288,536 W182* probably null Het
Rnmt A G 18: 68,307,652 K129E probably benign Het
Ruvbl1 T C 6: 88,473,126 F93S probably damaging Het
Scamp5 T C 9: 57,443,686 Y231C probably damaging Het
Sfxn5 T A 6: 85,267,939 probably null Het
Skiv2l A T 17: 34,849,999 V8D probably benign Het
Slc12a1 T C 2: 125,186,314 F510S probably damaging Het
Sowahb T C 5: 93,043,063 Y599C probably damaging Het
Speer4e T C 5: 14,937,097 N98S probably damaging Het
Stat3 T C 11: 100,893,981 N553S probably benign Het
Sult6b2 A T 6: 142,790,142 L242Q probably damaging Het
Tacc3 C T 5: 33,663,825 R98W possibly damaging Het
Tuba4a C T 1: 75,216,951 R112H Het
Ubr3 T A 2: 69,988,876 S1337T probably damaging Het
Vmn2r69 A T 7: 85,406,505 C808* probably null Het
Wnt16 G A 6: 22,288,998 A105T probably benign Het
Zfp692 C T 11: 58,307,734 S50L probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- CGTTTGTTTAACACGTTGGCC -3'
(R):5'- ACACACATTACCTGAGAAGGTG -3'

Sequencing Primer
(F):5'- CTGGATCTCACGCATGGTAC -3'
(R):5'- GATGTTGAATCCCTCATAGGACATGG -3'
Posted On2020-06-30