Incidental Mutation 'R8071:Prr14l'
ID 628902
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R8071 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32831164 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 329 (D329G)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000130134] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably benign
Transcript: ENSMUST00000120129
AA Change: D329G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: D329G

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130134
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,623,929 E963* probably null Het
Acads T C 5: 115,113,167 E86G probably benign Het
Agmo A G 12: 37,398,729 T217A probably damaging Het
Arhgap39 A G 15: 76,737,502 S300P probably benign Het
Casp12 T C 9: 5,346,647 L58P probably damaging Het
Ccar2 T C 14: 70,152,453 T24A probably benign Het
Ccndbp1 C A 2: 121,014,565 T321K unknown Het
Cd200r3 G A 16: 44,954,140 C172Y probably damaging Het
Chd2 T A 7: 73,537,384 H9L probably benign Het
Cramp1l T A 17: 24,982,700 S603C probably damaging Het
Crtac1 C T 19: 42,297,800 R448H probably damaging Het
Csmd2 A T 4: 128,393,538 Y1022F Het
Ctns T C 11: 73,184,934 Y363C probably damaging Het
D630044L22Rik A G 17: 25,960,144 T15A possibly damaging Het
Dhx38 A C 8: 109,558,701 I444M probably benign Het
Dnah14 A T 1: 181,615,894 I450F possibly damaging Het
Dpf1 T C 7: 29,314,141 F245L probably benign Het
Efr3b A G 12: 3,982,898 V269A probably benign Het
Eprs G T 1: 185,394,456 V530L possibly damaging Het
Eps8l2 A G 7: 141,342,947 N41S probably damaging Het
Erbb4 T C 1: 68,396,311 I142M probably damaging Het
Fam160a1 T C 3: 85,730,561 M144V probably damaging Het
Flnc A T 6: 29,457,446 D2381V probably damaging Het
Fndc1 T A 17: 7,772,530 D778V unknown Het
Galnt3 A G 2: 66,091,211 I492T probably benign Het
Gigyf2 T C 1: 87,446,433 M1261T probably damaging Het
Haus8 A G 8: 71,256,051 F126S probably benign Het
Hif3a A G 7: 17,048,761 L293S probably damaging Het
Ino80c G A 18: 24,106,650 T200I unknown Het
Jag1 T A 2: 137,101,797 M160L probably benign Het
Kcnj12 C A 11: 61,069,999 H374Q probably damaging Het
Lrrc27 A G 7: 139,236,986 I433M probably benign Het
Lyzl4 C T 9: 121,578,094 W123* probably null Het
Map2k4 A T 11: 65,707,001 C264S Het
Mmrn1 C T 6: 60,944,524 probably benign Het
Mug1 C T 6: 121,873,672 T709I probably benign Het
Myo9a T A 9: 59,874,648 W1706R probably benign Het
Nlrp5 A G 7: 23,418,444 E531G probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Pcdhb11 A C 18: 37,422,369 I251L probably benign Het
Per3 A G 4: 151,028,813 S353P probably damaging Het
Piezo1 T C 8: 122,487,011 E1738G probably null Het
Ptpn23 G T 9: 110,388,199 P863Q probably damaging Het
Ptpn23 G T 9: 110,388,200 P863T possibly damaging Het
Ptprq T C 10: 107,644,035 K1125E possibly damaging Het
Rapgef2 T G 3: 79,093,036 T351P probably damaging Het
Rbl2 A G 8: 91,113,989 Y923C probably damaging Het
Rimbp3 T C 16: 17,210,863 V717A probably benign Het
Rims1 C T 1: 22,288,536 W182* probably null Het
Rnmt A G 18: 68,307,652 K129E probably benign Het
Ruvbl1 T C 6: 88,473,126 F93S probably damaging Het
Scamp5 T C 9: 57,443,686 Y231C probably damaging Het
Sfxn5 T A 6: 85,267,939 probably null Het
Skiv2l A T 17: 34,849,999 V8D probably benign Het
Slc12a1 T C 2: 125,186,314 F510S probably damaging Het
Sowahb T C 5: 93,043,063 Y599C probably damaging Het
Speer4e T C 5: 14,937,097 N98S probably damaging Het
Stat3 T C 11: 100,893,981 N553S probably benign Het
Sult6b2 A T 6: 142,790,142 L242Q probably damaging Het
Tacc3 C T 5: 33,663,825 R98W possibly damaging Het
Tuba4a C T 1: 75,216,951 R112H Het
Ubr3 T A 2: 69,988,876 S1337T probably damaging Het
Vmn2r69 A T 7: 85,406,505 C808* probably null Het
Wnt16 G A 6: 22,288,998 A105T probably benign Het
Zfp692 C T 11: 58,307,734 S50L probably damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- AAGCTGCTTTCCTCAGAGC -3'
(R):5'- AGATACTGTAAAGCCCTCCGAAG -3'

Sequencing Primer
(F):5'- CCTCAGAGCGTTTCTCAGGATG -3'
(R):5'- TGTAAAGCCCTCCGAAGAAAATTC -3'
Posted On 2020-06-30