Incidental Mutation 'R0698:Ints7'
ID62893
Institutional Source Beutler Lab
Gene Symbol Ints7
Ensembl Gene ENSMUSG00000037461
Gene Nameintegrator complex subunit 7
Synonyms5930412E23Rik
MMRRC Submission 038882-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R0698 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191575636-191623688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 191594464 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 183 (M183V)
Ref Sequence ENSEMBL: ENSMUSP00000036277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000194785] [ENSMUST00000194877]
Predicted Effect probably damaging
Transcript: ENSMUST00000045450
AA Change: M183V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: M183V

DomainStartEndE-ValueType
SCOP:d1gw5a_ 76 530 1e-10 SMART
low complexity region 937 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194205
Predicted Effect probably benign
Transcript: ENSMUST00000194785
Predicted Effect probably benign
Transcript: ENSMUST00000194877
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 C T 16: 35,290,082 T873M possibly damaging Het
Ap4e1 G A 2: 127,063,363 E985K probably benign Het
Arhgap18 T C 10: 26,912,629 I579T probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Atm T C 9: 53,515,239 E573G probably damaging Het
Baz1b T C 5: 135,198,221 V92A probably damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Cpne4 T C 9: 104,925,795 S213P probably damaging Het
Dock10 T A 1: 80,530,178 Q1672L probably damaging Het
Grm8 C T 6: 27,363,914 C534Y probably damaging Het
Invs T G 4: 48,396,364 S346A probably benign Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Lrrtm4 T C 6: 80,022,928 L441P probably damaging Het
Map4 C T 9: 110,068,788 R81* probably null Het
Med1 A G 11: 98,155,689 probably benign Het
Necab1 T C 4: 15,005,041 N141S probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Pcdhb2 A T 18: 37,297,366 E797D probably benign Het
Pclo T C 5: 14,712,516 Y3668H unknown Het
Peg10 T A 6: 4,756,835 probably benign Het
Psd2 A G 18: 36,012,711 I723V probably benign Het
Ptprn2 C T 12: 116,722,130 R70* probably null Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab13 C T 3: 90,224,736 T69M probably damaging Het
Rpl32 T C 6: 115,805,590 N126S probably benign Het
Sis C A 3: 72,910,498 A1461S probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Spta1 T C 1: 174,181,104 L258P probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tet2 A T 3: 133,467,384 S1706T probably benign Het
Ttc6 G A 12: 57,673,216 V858I probably benign Het
Vps13c C A 9: 67,889,723 A464E probably benign Het
Zbtb17 T C 4: 141,466,096 probably null Het
Zcchc11 T A 4: 108,555,533 M1477K probably benign Het
Zcwpw1 G A 5: 137,817,521 E429K probably benign Het
Other mutations in Ints7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ints7 APN 1 191596164 splice site probably null
IGL01285:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01289:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01572:Ints7 APN 1 191615793 missense possibly damaging 0.71
IGL01665:Ints7 APN 1 191613219 splice site probably benign
IGL02059:Ints7 APN 1 191615760 missense probably benign 0.23
IGL02684:Ints7 APN 1 191613637 critical splice acceptor site probably null
IGL02686:Ints7 APN 1 191586592 missense probably damaging 1.00
IGL02812:Ints7 APN 1 191619741 missense probably damaging 1.00
IGL03119:Ints7 APN 1 191610365 missense probably damaging 1.00
IGL03162:Ints7 APN 1 191621412 utr 3 prime probably benign
PIT4810001:Ints7 UTSW 1 191596236 missense probably damaging 0.99
R0294:Ints7 UTSW 1 191611891 missense possibly damaging 0.91
R0479:Ints7 UTSW 1 191614554 intron probably null
R1420:Ints7 UTSW 1 191613057 missense possibly damaging 0.73
R1680:Ints7 UTSW 1 191621162 splice site probably null
R1781:Ints7 UTSW 1 191596284 missense possibly damaging 0.95
R2141:Ints7 UTSW 1 191604860 missense possibly damaging 0.73
R2291:Ints7 UTSW 1 191606203 synonymous probably null
R4718:Ints7 UTSW 1 191583277 missense possibly damaging 0.60
R4741:Ints7 UTSW 1 191619635 missense probably benign 0.29
R4797:Ints7 UTSW 1 191596933 missense probably damaging 1.00
R4812:Ints7 UTSW 1 191594430 missense possibly damaging 0.73
R4826:Ints7 UTSW 1 191611906 missense probably damaging 0.97
R4870:Ints7 UTSW 1 191596331 missense probably damaging 0.97
R5169:Ints7 UTSW 1 191613090 missense probably benign 0.00
R5281:Ints7 UTSW 1 191615771 missense possibly damaging 0.90
R5694:Ints7 UTSW 1 191586618 missense probably damaging 1.00
R5752:Ints7 UTSW 1 191575893 missense probably benign 0.00
R6048:Ints7 UTSW 1 191621412 utr 3 prime probably benign
R6341:Ints7 UTSW 1 191613127 missense probably damaging 1.00
R6419:Ints7 UTSW 1 191602302 missense possibly damaging 0.69
R7037:Ints7 UTSW 1 191619605 missense probably benign 0.16
R7163:Ints7 UTSW 1 191617837 missense possibly damaging 0.67
R7603:Ints7 UTSW 1 191596224 missense probably damaging 1.00
R7801:Ints7 UTSW 1 191615747 missense possibly damaging 0.84
R7899:Ints7 UTSW 1 191621315 missense probably damaging 1.00
R7982:Ints7 UTSW 1 191621315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTACTGCCAGAGCCTGCAAAG -3'
(R):5'- CAGGTAAAGCACAAGTCCTCCTGC -3'

Sequencing Primer
(F):5'- tgggaagcagaggcagg -3'
(R):5'- ATGTCACCCATGCTTGGGAC -3'
Posted On2013-07-30