Incidental Mutation 'R8071:Rimbp3'
ID 628940
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock # R8071 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17210863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 717 (V717A)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect probably benign
Transcript: ENSMUST00000169803
AA Change: V717A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: V717A

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,623,929 E963* probably null Het
Acads T C 5: 115,113,167 E86G probably benign Het
Agmo A G 12: 37,398,729 T217A probably damaging Het
Arhgap39 A G 15: 76,737,502 S300P probably benign Het
Casp12 T C 9: 5,346,647 L58P probably damaging Het
Ccar2 T C 14: 70,152,453 T24A probably benign Het
Ccndbp1 C A 2: 121,014,565 T321K unknown Het
Cd200r3 G A 16: 44,954,140 C172Y probably damaging Het
Chd2 T A 7: 73,537,384 H9L probably benign Het
Cramp1l T A 17: 24,982,700 S603C probably damaging Het
Crtac1 C T 19: 42,297,800 R448H probably damaging Het
Csmd2 A T 4: 128,393,538 Y1022F Het
Ctns T C 11: 73,184,934 Y363C probably damaging Het
D630044L22Rik A G 17: 25,960,144 T15A possibly damaging Het
Dhx38 A C 8: 109,558,701 I444M probably benign Het
Dnah14 A T 1: 181,615,894 I450F possibly damaging Het
Dpf1 T C 7: 29,314,141 F245L probably benign Het
Efr3b A G 12: 3,982,898 V269A probably benign Het
Eprs G T 1: 185,394,456 V530L possibly damaging Het
Eps8l2 A G 7: 141,342,947 N41S probably damaging Het
Erbb4 T C 1: 68,396,311 I142M probably damaging Het
Fam160a1 T C 3: 85,730,561 M144V probably damaging Het
Flnc A T 6: 29,457,446 D2381V probably damaging Het
Fndc1 T A 17: 7,772,530 D778V unknown Het
Galnt3 A G 2: 66,091,211 I492T probably benign Het
Gigyf2 T C 1: 87,446,433 M1261T probably damaging Het
Haus8 A G 8: 71,256,051 F126S probably benign Het
Hif3a A G 7: 17,048,761 L293S probably damaging Het
Ino80c G A 18: 24,106,650 T200I unknown Het
Jag1 T A 2: 137,101,797 M160L probably benign Het
Kcnj12 C A 11: 61,069,999 H374Q probably damaging Het
Lrrc27 A G 7: 139,236,986 I433M probably benign Het
Lyzl4 C T 9: 121,578,094 W123* probably null Het
Map2k4 A T 11: 65,707,001 C264S Het
Mmrn1 C T 6: 60,944,524 probably benign Het
Mug1 C T 6: 121,873,672 T709I probably benign Het
Myo9a T A 9: 59,874,648 W1706R probably benign Het
Nlrp5 A G 7: 23,418,444 E531G probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Pcdhb11 A C 18: 37,422,369 I251L probably benign Het
Per3 A G 4: 151,028,813 S353P probably damaging Het
Piezo1 T C 8: 122,487,011 E1738G probably null Het
Prr14l T C 5: 32,831,164 D329G probably benign Het
Ptpn23 G T 9: 110,388,199 P863Q probably damaging Het
Ptpn23 G T 9: 110,388,200 P863T possibly damaging Het
Ptprq T C 10: 107,644,035 K1125E possibly damaging Het
Rapgef2 T G 3: 79,093,036 T351P probably damaging Het
Rbl2 A G 8: 91,113,989 Y923C probably damaging Het
Rims1 C T 1: 22,288,536 W182* probably null Het
Rnmt A G 18: 68,307,652 K129E probably benign Het
Ruvbl1 T C 6: 88,473,126 F93S probably damaging Het
Scamp5 T C 9: 57,443,686 Y231C probably damaging Het
Sfxn5 T A 6: 85,267,939 probably null Het
Skiv2l A T 17: 34,849,999 V8D probably benign Het
Slc12a1 T C 2: 125,186,314 F510S probably damaging Het
Sowahb T C 5: 93,043,063 Y599C probably damaging Het
Speer4e T C 5: 14,937,097 N98S probably damaging Het
Stat3 T C 11: 100,893,981 N553S probably benign Het
Sult6b2 A T 6: 142,790,142 L242Q probably damaging Het
Tacc3 C T 5: 33,663,825 R98W possibly damaging Het
Tuba4a C T 1: 75,216,951 R112H Het
Ubr3 T A 2: 69,988,876 S1337T probably damaging Het
Vmn2r69 A T 7: 85,406,505 C808* probably null Het
Wnt16 G A 6: 22,288,998 A105T probably benign Het
Zfp692 C T 11: 58,307,734 S50L probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8272:Rimbp3 UTSW 16 17209105 missense possibly damaging 0.85
R8419:Rimbp3 UTSW 16 17213022 missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R8982:Rimbp3 UTSW 16 17209647 missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17208756 missense possibly damaging 0.93
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCAGCTGCAGCACTACAAG -3'
(R):5'- TCCATGTCCAAAGAAAGGCAAG -3'

Sequencing Primer
(F):5'- AGAATAAAGCCCTAAGTGACCTTAG -3'
(R):5'- ACATGGACTCTACCTCTGAGGAG -3'
Posted On 2020-06-30