Incidental Mutation 'R8071:Cramp1'
ID 628943
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission 067506-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8071 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25201674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 603 (S603C)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: S603C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: S603C

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads T C 5: 115,251,226 (GRCm39) E86G probably benign Het
Agmo A G 12: 37,448,728 (GRCm39) T217A probably damaging Het
Arhgap39 A G 15: 76,621,702 (GRCm39) S300P probably benign Het
Casp12 T C 9: 5,346,647 (GRCm39) L58P probably damaging Het
Ccar2 T C 14: 70,389,902 (GRCm39) T24A probably benign Het
Ccndbp1 C A 2: 120,845,046 (GRCm39) T321K unknown Het
Cd200r3 G A 16: 44,774,503 (GRCm39) C172Y probably damaging Het
Chd2 T A 7: 73,187,132 (GRCm39) H9L probably benign Het
Cracdl C A 1: 37,663,010 (GRCm39) E963* probably null Het
Crtac1 C T 19: 42,286,239 (GRCm39) R448H probably damaging Het
Csmd2 A T 4: 128,287,331 (GRCm39) Y1022F Het
Ctns T C 11: 73,075,760 (GRCm39) Y363C probably damaging Het
D630044L22Rik A G 17: 26,179,118 (GRCm39) T15A possibly damaging Het
Dhx38 A C 8: 110,285,333 (GRCm39) I444M probably benign Het
Dnah14 A T 1: 181,443,459 (GRCm39) I450F possibly damaging Het
Dpf1 T C 7: 29,013,566 (GRCm39) F245L probably benign Het
Efr3b A G 12: 4,032,898 (GRCm39) V269A probably benign Het
Eprs1 G T 1: 185,126,653 (GRCm39) V530L possibly damaging Het
Eps8l2 A G 7: 140,922,860 (GRCm39) N41S probably damaging Het
Erbb4 T C 1: 68,435,470 (GRCm39) I142M probably damaging Het
Fhip1a T C 3: 85,637,868 (GRCm39) M144V probably damaging Het
Flnc A T 6: 29,457,445 (GRCm39) D2381V probably damaging Het
Fndc1 T A 17: 7,991,362 (GRCm39) D778V unknown Het
Galnt3 A G 2: 65,921,555 (GRCm39) I492T probably benign Het
Gigyf2 T C 1: 87,374,155 (GRCm39) M1261T probably damaging Het
Haus8 A G 8: 71,708,695 (GRCm39) F126S probably benign Het
Hif3a A G 7: 16,782,686 (GRCm39) L293S probably damaging Het
Ino80c G A 18: 24,239,707 (GRCm39) T200I unknown Het
Jag1 T A 2: 136,943,717 (GRCm39) M160L probably benign Het
Kcnj12 C A 11: 60,960,825 (GRCm39) H374Q probably damaging Het
Lrrc27 A G 7: 138,816,902 (GRCm39) I433M probably benign Het
Lyzl4 C T 9: 121,407,160 (GRCm39) W123* probably null Het
Map2k4 A T 11: 65,597,827 (GRCm39) C264S Het
Mmrn1 C T 6: 60,921,508 (GRCm39) probably benign Het
Mug1 C T 6: 121,850,631 (GRCm39) T709I probably benign Het
Myo9a T A 9: 59,781,931 (GRCm39) W1706R probably benign Het
Nlrp5 A G 7: 23,117,869 (GRCm39) E531G probably damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Pcdhb11 A C 18: 37,555,422 (GRCm39) I251L probably benign Het
Per3 A G 4: 151,113,270 (GRCm39) S353P probably damaging Het
Piezo1 T C 8: 123,213,750 (GRCm39) E1738G probably null Het
Prr14l T C 5: 32,988,508 (GRCm39) D329G probably benign Het
Ptpn23 G T 9: 110,217,267 (GRCm39) P863Q probably damaging Het
Ptpn23 G T 9: 110,217,268 (GRCm39) P863T possibly damaging Het
Ptprq T C 10: 107,479,896 (GRCm39) K1125E possibly damaging Het
Rapgef2 T G 3: 79,000,343 (GRCm39) T351P probably damaging Het
Rbl2 A G 8: 91,840,617 (GRCm39) Y923C probably damaging Het
Rimbp3 T C 16: 17,028,727 (GRCm39) V717A probably benign Het
Rims1 C T 1: 22,358,760 (GRCm39) W182* probably null Het
Rnmt A G 18: 68,440,723 (GRCm39) K129E probably benign Het
Ruvbl1 T C 6: 88,450,108 (GRCm39) F93S probably damaging Het
Scamp5 T C 9: 57,350,969 (GRCm39) Y231C probably damaging Het
Sfxn5 T A 6: 85,244,921 (GRCm39) probably null Het
Skic2 A T 17: 35,068,975 (GRCm39) V8D probably benign Het
Slc12a1 T C 2: 125,028,234 (GRCm39) F510S probably damaging Het
Sowahb T C 5: 93,190,922 (GRCm39) Y599C probably damaging Het
Speer4e1 T C 5: 14,987,111 (GRCm39) N98S probably damaging Het
Stat3 T C 11: 100,784,807 (GRCm39) N553S probably benign Het
Sult6b2 A T 6: 142,735,868 (GRCm39) L242Q probably damaging Het
Tacc3 C T 5: 33,821,169 (GRCm39) R98W possibly damaging Het
Tuba4a C T 1: 75,193,595 (GRCm39) R112H Het
Ubr3 T A 2: 69,819,220 (GRCm39) S1337T probably damaging Het
Vmn2r69 A T 7: 85,055,713 (GRCm39) C808* probably null Het
Wnt16 G A 6: 22,288,997 (GRCm39) A105T probably benign Het
Zfp692 C T 11: 58,198,560 (GRCm39) S50L probably damaging Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTCCTTGGAAGGCCTGGTAG -3'
(R):5'- CCTATTCAAGAATCTGGGGCCC -3'

Sequencing Primer
(F):5'- TGGTAGCAGGCTGTCCC -3'
(R):5'- CCTGCCGTGTCCCTGTG -3'
Posted On 2020-06-30