Mutagenetix > Incidental Mutation

Incidental Mutation 'R8075:Acad10'

628959

Institutional Source

Beutler Lab

Gene Symbol

Acad10

Ensembl Gene

ENSMUSG00000029456

Gene Name

acyl-Coenzyme A dehydrogenase family, member 10

Synonyms

2410021P16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8075 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121621026-121660514 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121652085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 69 (H69Q)

Ref Sequence

ENSEMBL: ENSMUSP00000031412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]

AlphaFold

Q8K370

Predicted Effect

probably benign
Transcript: ENSMUST00000031412
AA Change: H69Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: H69Q

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	1.6e-14	PFAM
Pfam:Hydrolase	88	225	5e-8	PFAM
Pfam:APH	287	531	1.8e-52	PFAM
Pfam:Acyl-CoA_dh_N	660	787	1.7e-15	PFAM
Pfam:Acyl-CoA_dh_M	791	892	2.7e-20	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	1.1e-35	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	6.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111770
AA Change: H69Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: H69Q

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	2.3e-14	PFAM
Pfam:APH	287	523	3.2e-50	PFAM
Pfam:EcKinase	390	504	5.2e-8	PFAM
Pfam:Acyl-CoA_dh_N	660	787	3.4e-14	PFAM
Pfam:Acyl-CoA_dh_M	791	845	2.7e-13	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	9.4e-36	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	1.6e-14	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 98.8%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	T	A	17: 35,171,835	N87Y	unknown	Het
Caprin2	A	T	6: 148,869,092	V468E	probably benign	Het
Cep68	A	T	11: 20,239,335	V559D	probably benign	Het
Chrna4	A	C	2: 181,039,066	I3S	unknown	Het
Cog3	T	C	14: 75,730,702	Y407C	probably damaging	Het
Col15a1	A	G	4: 47,208,359	H3R	probably benign	Het
Ctxn1	A	G	8: 4,258,553	V26A	probably benign	Het
Cyp27b1	A	C	10: 127,051,513	T405P	probably damaging	Het
Cyp2c65	A	G	19: 39,072,238	I181V	probably benign	Het
Dusp6	T	A	10: 99,264,948	S269T	possibly damaging	Het
Efcab6	A	T	15: 83,967,623	D351E	probably damaging	Het
Fam181a	A	T	12: 103,316,037	H67L	possibly damaging	Het
Fbxl18	A	G	5: 142,886,106	L458P	probably damaging	Het
Flnb	T	C	14: 7,913,048	I1439T	probably benign	Het
Foxj2	C	T	6: 122,838,096	Q364*	probably null	Het
Gm3138	A	T	14: 4,250,532	N55Y	probably damaging	Het
Hmcn2	A	G	2: 31,389,391	T1802A	possibly damaging	Het
Hoxc6	T	C	15: 103,010,893	I187T	probably damaging	Het
Ighg3	T	A	12: 113,357,477	I387F		Het
Insr	A	T	8: 3,155,862	M1309K	probably benign	Het
Itsn1	A	T	16: 91,889,209	N1290I	unknown	Het
Jag2	C	A	12: 112,915,274	R509L	probably benign	Het
Kctd11	T	A	11: 69,880,269		probably benign	Het
Med13	C	A	11: 86,272,470	V2126F	probably damaging	Het
Mgea5	A	T	19: 45,761,182	N699K	probably damaging	Het
Mknk2	G	A	10: 80,672,148		probably benign	Het
Olfr1026	A	G	2: 85,924,126	N286S	probably benign	Het
Olfr685	T	G	7: 105,181,136	H74P	probably damaging	Het
Pdzrn4	T	C	15: 92,677,724	V337A	probably damaging	Het
Pik3c3	A	G	18: 30,305,029	N491D	probably damaging	Het
Pla2g12b	T	A	10: 59,421,452	S96T	unknown	Het
Rab37	G	T	11: 115,091,933		probably null	Het
Rp9	G	A	9: 22,457,492	T57M	probably damaging	Het
Rrp12	A	G	19: 41,863,274	V1274A	probably damaging	Het
Serpinb11	G	A	1: 107,370,789	V57M	probably damaging	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc39a14	A	T	14: 70,308,798	I392N	possibly damaging	Het
Sowahb	G	A	5: 93,044,417	Q148*	probably null	Het
Spon1	T	C	7: 114,016,793		probably null	Het
Susd4	C	A	1: 182,765,183	T48K	possibly damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tas2r139	T	A	6: 42,141,220	N95K	probably benign	Het
Tle3	T	C	9: 61,374,559	M57T	probably benign	Het
Usp13	T	A	3: 32,931,703	M815K	probably damaging	Het
Vps8	A	G	16: 21,521,894	D796G	probably damaging	Het
Wnk1	C	T	6: 119,932,714	G41S	probably damaging	Het
Zfp867	A	G	11: 59,464,240	S88P	probably benign	Het

Other mutations in Acad10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02379:Acad10	APN	5	121622043	missense	probably damaging	1.00
IGL02469:Acad10	APN	5	121645459	missense	probably damaging	1.00
IGL02526:Acad10	APN	5	121646860	missense	probably damaging	0.99
IGL02623:Acad10	APN	5	121629930	missense	possibly damaging	0.94
IGL02643:Acad10	APN	5	121631570	missense	probably benign
IGL02685:Acad10	APN	5	121632609	missense	probably benign
IGL03139:Acad10	APN	5	121626082	missense	probably benign
IGL03267:Acad10	APN	5	121637349	missense	probably benign	0.34
P0026:Acad10	UTSW	5	121637352	missense	probably damaging	1.00
R0099:Acad10	UTSW	5	121621290	missense	probably damaging	1.00
R0453:Acad10	UTSW	5	121627382	nonsense	probably null
R1051:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R1052:Acad10	UTSW	5	121649541	missense	possibly damaging	0.65
R1116:Acad10	UTSW	5	121630751	missense	probably damaging	1.00
R1548:Acad10	UTSW	5	121626040	splice site	probably benign
R1548:Acad10	UTSW	5	121626041	splice site	probably benign
R1571:Acad10	UTSW	5	121621348	missense	probably damaging	0.99
R1592:Acad10	UTSW	5	121645381	missense	probably damaging	0.99
R1741:Acad10	UTSW	5	121647836	missense	probably damaging	1.00
R1789:Acad10	UTSW	5	121631393	missense	possibly damaging	0.67
R1974:Acad10	UTSW	5	121626185	missense	possibly damaging	0.95
R2007:Acad10	UTSW	5	121634751	missense	probably damaging	1.00
R2085:Acad10	UTSW	5	121649460	missense	possibly damaging	0.79
R2351:Acad10	UTSW	5	121629927	missense	probably benign	0.23
R2511:Acad10	UTSW	5	121631567	missense	probably benign	0.02
R2570:Acad10	UTSW	5	121630204	missense	probably damaging	1.00
R3824:Acad10	UTSW	5	121622818	missense	probably benign
R3846:Acad10	UTSW	5	121634686	missense	probably benign	0.19
R4106:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4107:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4108:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R5569:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R5704:Acad10	UTSW	5	121631543	missense	probably benign	0.03
R5845:Acad10	UTSW	5	121626083	missense	probably benign
R5990:Acad10	UTSW	5	121645405	missense	probably damaging	1.00
R6019:Acad10	UTSW	5	121634801	missense	possibly damaging	0.88
R6145:Acad10	UTSW	5	121622033	missense	probably damaging	0.97
R6384:Acad10	UTSW	5	121652003	missense	probably benign	0.43
R6491:Acad10	UTSW	5	121630157	missense	probably damaging	1.00
R6608:Acad10	UTSW	5	121632492	missense	probably benign	0.02
R6941:Acad10	UTSW	5	121649357	missense	probably damaging	1.00
R7221:Acad10	UTSW	5	121630210	missense	probably damaging	1.00
R7283:Acad10	UTSW	5	121649475	missense	possibly damaging	0.79
R7355:Acad10	UTSW	5	121630717	nonsense	probably null
R7483:Acad10	UTSW	5	121656012	critical splice donor site	probably null
R7553:Acad10	UTSW	5	121639255	missense	probably damaging	1.00
R7721:Acad10	UTSW	5	121646866	splice site	probably null
R8400:Acad10	UTSW	5	121626205	missense	possibly damaging	0.82
R9171:Acad10	UTSW	5	121629918	missense	probably benign	0.14
X0061:Acad10	UTSW	5	121622813	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAATGGGAGCATACTTGAGGTC -3'
(R):5'- TGAGACTGGACCCTCAGTAG -3'

Sequencing Primer
(F):5'- TCAGCAGTTCAAGGGCAC -3'
(R):5'- ACTGGACCCTCAGTAGCCCTG -3'

Posted On

2020-06-30