Incidental Mutation 'R8075:Spon1'
ID 628966
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R8075 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 114016793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687]
AlphaFold Q8VCC9
Predicted Effect probably null
Transcript: ENSMUST00000046687
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,652,085 H69Q probably benign Het
Aif1 T A 17: 35,171,835 N87Y unknown Het
Caprin2 A T 6: 148,869,092 V468E probably benign Het
Cep68 A T 11: 20,239,335 V559D probably benign Het
Chrna4 A C 2: 181,039,066 I3S unknown Het
Cog3 T C 14: 75,730,702 Y407C probably damaging Het
Col15a1 A G 4: 47,208,359 H3R probably benign Het
Ctxn1 A G 8: 4,258,553 V26A probably benign Het
Cyp27b1 A C 10: 127,051,513 T405P probably damaging Het
Cyp2c65 A G 19: 39,072,238 I181V probably benign Het
Dusp6 T A 10: 99,264,948 S269T possibly damaging Het
Efcab6 A T 15: 83,967,623 D351E probably damaging Het
Fam181a A T 12: 103,316,037 H67L possibly damaging Het
Fbxl18 A G 5: 142,886,106 L458P probably damaging Het
Flnb T C 14: 7,913,048 I1439T probably benign Het
Foxj2 C T 6: 122,838,096 Q364* probably null Het
Gm3138 A T 14: 4,250,532 N55Y probably damaging Het
Hmcn2 A G 2: 31,389,391 T1802A possibly damaging Het
Hoxc6 T C 15: 103,010,893 I187T probably damaging Het
Ighg3 T A 12: 113,357,477 I387F Het
Insr A T 8: 3,155,862 M1309K probably benign Het
Itsn1 A T 16: 91,889,209 N1290I unknown Het
Jag2 C A 12: 112,915,274 R509L probably benign Het
Kctd11 T A 11: 69,880,269 probably benign Het
Med13 C A 11: 86,272,470 V2126F probably damaging Het
Mgea5 A T 19: 45,761,182 N699K probably damaging Het
Mknk2 G A 10: 80,672,148 probably benign Het
Olfr1026 A G 2: 85,924,126 N286S probably benign Het
Olfr685 T G 7: 105,181,136 H74P probably damaging Het
Pdzrn4 T C 15: 92,677,724 V337A probably damaging Het
Pik3c3 A G 18: 30,305,029 N491D probably damaging Het
Pla2g12b T A 10: 59,421,452 S96T unknown Het
Rab37 G T 11: 115,091,933 probably null Het
Rp9 G A 9: 22,457,492 T57M probably damaging Het
Rrp12 A G 19: 41,863,274 V1274A probably damaging Het
Serpinb11 G A 1: 107,370,789 V57M probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc39a14 A T 14: 70,308,798 I392N possibly damaging Het
Sowahb G A 5: 93,044,417 Q148* probably null Het
Susd4 C A 1: 182,765,183 T48K possibly damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tas2r139 T A 6: 42,141,220 N95K probably benign Het
Tle3 T C 9: 61,374,559 M57T probably benign Het
Usp13 T A 3: 32,931,703 M815K probably damaging Het
Vps8 A G 16: 21,521,894 D796G probably damaging Het
Wnk1 C T 6: 119,932,714 G41S probably damaging Het
Zfp867 A G 11: 59,464,240 S88P probably benign Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8064:Spon1 UTSW 7 114036621 missense probably damaging 1.00
R8927:Spon1 UTSW 7 114030357 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
R9278:Spon1 UTSW 7 114028953 missense probably damaging 1.00
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGACTAGGAACACTCAGTGC -3'
(R):5'- CTGTAGTCCCAAGAAGACAAGG -3'

Sequencing Primer
(F):5'- ACCTCCTAGTGTAGCTGGCATG -3'
(R):5'- TGTAGTCCCAAGAAGACAAGGTTTCC -3'
Posted On 2020-06-30