Incidental Mutation 'R8075:Tle3'
ID628970
Institutional Source Beutler Lab
Gene Symbol Tle3
Ensembl Gene ENSMUSG00000032280
Gene Nametransducin-like enhancer of split 3
Synonyms2610103N05Rik, ESG, Grg3a, Grg3b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8075 (G1)
Quality Score176.009
Status Not validated
Chromosome9
Chromosomal Location61372366-61418497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61374559 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 57 (M57T)
Ref Sequence ENSEMBL: ENSMUSP00000034820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034820] [ENSMUST00000159050] [ENSMUST00000159386] [ENSMUST00000159630] [ENSMUST00000160541] [ENSMUST00000160724] [ENSMUST00000160882] [ENSMUST00000161194] [ENSMUST00000161207] [ENSMUST00000161689] [ENSMUST00000161993] [ENSMUST00000162127] [ENSMUST00000162583] [ENSMUST00000162973] [ENSMUST00000178113]
Predicted Effect probably benign
Transcript: ENSMUST00000034820
AA Change: M57T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034820
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 4.3e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 468 505 2.96e-2 SMART
WD40 511 552 4.48e-2 SMART
WD40 557 596 2.84e-4 SMART
WD40 599 638 7.55e-9 SMART
WD40 641 679 3.07e1 SMART
WD40 681 720 4.18e-2 SMART
WD40 721 761 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159050
AA Change: M57T

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125032
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 471 508 2.96e-2 SMART
WD40 514 555 4.48e-2 SMART
WD40 560 599 2.84e-4 SMART
WD40 602 641 7.55e-9 SMART
WD40 644 682 3.07e1 SMART
WD40 684 723 4.18e-2 SMART
WD40 724 764 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159386
AA Change: M57T

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125049
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 464 501 2.96e-2 SMART
WD40 507 548 4.48e-2 SMART
WD40 553 592 2.84e-4 SMART
WD40 595 634 7.55e-9 SMART
WD40 637 675 3.07e1 SMART
WD40 677 716 4.18e-2 SMART
WD40 717 757 1.79e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159630
AA Change: M1T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123723
Gene: ENSMUSG00000032280
AA Change: M1T

DomainStartEndE-ValueType
Pfam:TLE_N 1 79 1.7e-43 PFAM
low complexity region 104 122 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
low complexity region 226 245 N/A INTRINSIC
WD40 416 453 2.96e-2 SMART
WD40 459 500 4.48e-2 SMART
WD40 505 544 2.84e-4 SMART
WD40 547 586 7.55e-9 SMART
WD40 589 627 3.07e1 SMART
WD40 629 668 4.18e-2 SMART
WD40 669 709 1.79e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160541
AA Change: M1T

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124158
Gene: ENSMUSG00000032280
AA Change: M1T

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 3.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160724
AA Change: M57T

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124055
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 145 1.9e-77 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 204 216 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160882
AA Change: M57T

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124131
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 146 4.8e-76 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
low complexity region 293 312 N/A INTRINSIC
WD40 486 523 2.96e-2 SMART
WD40 529 570 4.48e-2 SMART
WD40 575 614 2.84e-4 SMART
WD40 617 656 7.55e-9 SMART
WD40 659 697 3.07e1 SMART
WD40 699 738 4.18e-2 SMART
WD40 739 779 1.79e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161194
AA Change: M1T

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125537
Gene: ENSMUSG00000032280
AA Change: M1T

DomainStartEndE-ValueType
Pfam:TLE_N 1 53 7.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161207
AA Change: M50T

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124557
Gene: ENSMUSG00000032280
AA Change: M50T

DomainStartEndE-ValueType
Pfam:TLE_N 1 129 1e-73 PFAM
low complexity region 154 172 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
WD40 466 503 2.96e-2 SMART
WD40 509 550 4.48e-2 SMART
WD40 555 594 2.84e-4 SMART
WD40 597 636 7.55e-9 SMART
WD40 639 677 3.07e1 SMART
WD40 679 718 4.18e-2 SMART
WD40 719 759 1.79e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161689
AA Change: M1T

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125011
Gene: ENSMUSG00000032280
AA Change: M1T

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 4.8e-44 PFAM
low complexity region 105 123 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 227 246 N/A INTRINSIC
WD40 420 457 2.96e-2 SMART
WD40 463 504 4.48e-2 SMART
WD40 509 548 2.84e-4 SMART
WD40 551 590 7.55e-9 SMART
WD40 593 631 3.07e1 SMART
WD40 633 672 4.18e-2 SMART
WD40 673 713 1.79e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161993
AA Change: M57T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124432
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 135 2e-77 PFAM
low complexity region 160 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162127
SMART Domains Protein: ENSMUSP00000124150
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 83 1.2e-37 PFAM
low complexity region 108 126 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
WD40 406 443 2.96e-2 SMART
WD40 449 490 4.48e-2 SMART
WD40 495 534 2.84e-4 SMART
WD40 537 576 7.55e-9 SMART
WD40 579 617 3.07e1 SMART
WD40 619 658 4.18e-2 SMART
WD40 659 699 1.79e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162583
AA Change: M57T

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124977
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 473 510 2.96e-2 SMART
WD40 516 557 4.48e-2 SMART
WD40 562 601 2.84e-4 SMART
WD40 604 643 7.55e-9 SMART
WD40 646 684 3.07e1 SMART
WD40 686 725 4.18e-2 SMART
WD40 726 766 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162973
AA Change: M57T

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124173
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 476 513 2.96e-2 SMART
WD40 519 560 4.48e-2 SMART
WD40 565 604 2.84e-4 SMART
WD40 607 646 7.55e-9 SMART
WD40 649 687 3.07e1 SMART
WD40 689 728 4.18e-2 SMART
WD40 729 769 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178113
AA Change: M57T

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136010
Gene: ENSMUSG00000032280
AA Change: M57T

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 6e-73 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 294 313 N/A INTRINSIC
WD40 487 524 2.96e-2 SMART
WD40 530 571 4.48e-2 SMART
WD40 576 615 2.84e-4 SMART
WD40 618 657 7.55e-9 SMART
WD40 660 698 3.07e1 SMART
WD40 700 739 4.18e-2 SMART
WD40 740 780 1.79e-1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-repressor protein that belongs to the transducin-like enhancer family of proteins. The members of this family function in the Notch signaling pathway that regulates determination of cell fate during development. Expression of this gene has been associated with a favorable outcome to chemotherapy with taxanes for ovarian carcinoma. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homzoygous for a gene trap allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,652,085 H69Q probably benign Het
Aif1 T A 17: 35,171,835 N87Y unknown Het
Caprin2 A T 6: 148,869,092 V468E probably benign Het
Cep68 A T 11: 20,239,335 V559D probably benign Het
Chrna4 A C 2: 181,039,066 I3S unknown Het
Cog3 T C 14: 75,730,702 Y407C probably damaging Het
Col15a1 A G 4: 47,208,359 H3R probably benign Het
Ctxn1 A G 8: 4,258,553 V26A probably benign Het
Cyp27b1 A C 10: 127,051,513 T405P probably damaging Het
Cyp2c65 A G 19: 39,072,238 I181V probably benign Het
Dusp6 T A 10: 99,264,948 S269T possibly damaging Het
Efcab6 A T 15: 83,967,623 D351E probably damaging Het
Fam181a A T 12: 103,316,037 H67L possibly damaging Het
Fbxl18 A G 5: 142,886,106 L458P probably damaging Het
Flnb T C 14: 7,913,048 I1439T probably benign Het
Foxj2 C T 6: 122,838,096 Q364* probably null Het
Gm3138 A T 14: 4,250,532 N55Y probably damaging Het
Hmcn2 A G 2: 31,389,391 T1802A possibly damaging Het
Hoxc6 T C 15: 103,010,893 I187T probably damaging Het
Ighg3 T A 12: 113,357,477 I387F Het
Insr A T 8: 3,155,862 M1309K probably benign Het
Itsn1 A T 16: 91,889,209 N1290I unknown Het
Jag2 C A 12: 112,915,274 R509L probably benign Het
Kctd11 T A 11: 69,880,269 probably benign Het
Med13 C A 11: 86,272,470 V2126F probably damaging Het
Mgea5 A T 19: 45,761,182 N699K probably damaging Het
Mknk2 G A 10: 80,672,148 probably benign Het
Olfr1026 A G 2: 85,924,126 N286S probably benign Het
Olfr685 T G 7: 105,181,136 H74P probably damaging Het
Pdzrn4 T C 15: 92,677,724 V337A probably damaging Het
Pik3c3 A G 18: 30,305,029 N491D probably damaging Het
Pla2g12b T A 10: 59,421,452 S96T unknown Het
Rab37 G T 11: 115,091,933 probably null Het
Rp9 G A 9: 22,457,492 T57M probably damaging Het
Rrp12 A G 19: 41,863,274 V1274A probably damaging Het
Serpinb11 G A 1: 107,370,789 V57M probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc39a14 A T 14: 70,308,798 I392N possibly damaging Het
Sowahb G A 5: 93,044,417 Q148* probably null Het
Spon1 T C 7: 114,016,793 probably null Het
Susd4 C A 1: 182,765,183 T48K possibly damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tas2r139 T A 6: 42,141,220 N95K probably benign Het
Usp13 T A 3: 32,931,703 M815K probably damaging Het
Vps8 A G 16: 21,521,894 D796G probably damaging Het
Wnk1 C T 6: 119,932,714 G41S probably damaging Het
Zfp867 A G 11: 59,464,240 S88P probably benign Het
Other mutations in Tle3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Tle3 APN 9 61408757 splice site probably benign
IGL00671:Tle3 APN 9 61412370 missense probably damaging 1.00
IGL01583:Tle3 APN 9 61410025 missense probably benign 0.00
IGL01684:Tle3 APN 9 61403446 intron probably benign
IGL02109:Tle3 APN 9 61413050 missense probably damaging 1.00
IGL02386:Tle3 APN 9 61394659 missense possibly damaging 0.88
IGL02517:Tle3 APN 9 61414781 missense probably damaging 1.00
IGL02930:Tle3 APN 9 61394699 missense possibly damaging 0.52
IGL03103:Tle3 APN 9 61393242 missense possibly damaging 0.46
R0391:Tle3 UTSW 9 61416661 missense probably damaging 1.00
R0395:Tle3 UTSW 9 61410071 missense probably damaging 0.99
R0621:Tle3 UTSW 9 61410105 nonsense probably null
R1836:Tle3 UTSW 9 61414023 missense probably damaging 1.00
R1921:Tle3 UTSW 9 61411340 critical splice donor site probably null
R1978:Tle3 UTSW 9 61394633 missense probably damaging 1.00
R3434:Tle3 UTSW 9 61414094 splice site probably null
R4242:Tle3 UTSW 9 61407423 missense probably benign
R4587:Tle3 UTSW 9 61374013 missense probably damaging 0.99
R4811:Tle3 UTSW 9 61373997 unclassified probably benign
R4877:Tle3 UTSW 9 61373499 intron probably benign
R4913:Tle3 UTSW 9 61373993 missense probably damaging 1.00
R5387:Tle3 UTSW 9 61407489 splice site probably null
R5745:Tle3 UTSW 9 61414851 missense probably damaging 1.00
R5752:Tle3 UTSW 9 61407471 missense probably damaging 1.00
R5917:Tle3 UTSW 9 61408908 missense probably benign 0.19
R6000:Tle3 UTSW 9 61374014 missense probably damaging 1.00
R6339:Tle3 UTSW 9 61401924 splice site probably null
R7210:Tle3 UTSW 9 61412305 missense probably damaging 1.00
R7460:Tle3 UTSW 9 61413084 missense probably damaging 0.99
R7545:Tle3 UTSW 9 61394702 missense possibly damaging 0.62
R7698:Tle3 UTSW 9 61412856 missense probably damaging 1.00
R7916:Tle3 UTSW 9 61407128 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTGGTACTGCTAGGCTCC -3'
(R):5'- CCAGGAATGTGTTTCTCTTTCG -3'

Sequencing Primer
(F):5'- TACTGCTAGGCTCCGGGTG -3'
(R):5'- TTTCGGCCTCCAAGTGGC -3'
Posted On2020-06-30