Incidental Mutation 'R8075:Pla2g12b'
ID628971
Institutional Source Beutler Lab
Gene Symbol Pla2g12b
Ensembl Gene ENSMUSG00000009646
Gene Namephospholipase A2, group XIIB
Synonyms2010002E04Rik, hlb218, Pla2g13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R8075 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location59403660-59421976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59421452 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 96 (S96T)
Ref Sequence ENSEMBL: ENSMUSP00000123842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009790] [ENSMUST00000009798] [ENSMUST00000162643]
Predicted Effect probably benign
Transcript: ENSMUST00000009790
SMART Domains Protein: ENSMUSP00000009790
Gene: ENSMUSG00000009646

DomainStartEndE-ValueType
Pfam:PLA2G12 12 195 1.5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009798
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162643
AA Change: S96T
SMART Domains Protein: ENSMUSP00000123842
Gene: ENSMUSG00000009646
AA Change: S96T

DomainStartEndE-ValueType
Pfam:PLA2G12 1 77 1.7e-36 PFAM
low complexity region 90 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phospholipase A2 (PLA2) group of enzymes, which function in glycolipid hydrolysis with the release of free fatty acids and lysophospholipids. This family member has altered phospholipid-binding properties and is catalytically inactive. The protein is secreted, and together with microsomal triglyceride transfer protein, it functions to regulate HNF4alpha-induced hepatitis C virus infectivity. The expression of this gene is down-regulated in various tumors, suggesting that it may function as a negative regulator of tumor progression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit a reduction in serum total and HDL cholesterol levels, decreased serum triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,652,085 H69Q probably benign Het
Aif1 T A 17: 35,171,835 N87Y unknown Het
Caprin2 A T 6: 148,869,092 V468E probably benign Het
Cep68 A T 11: 20,239,335 V559D probably benign Het
Chrna4 A C 2: 181,039,066 I3S unknown Het
Cog3 T C 14: 75,730,702 Y407C probably damaging Het
Col15a1 A G 4: 47,208,359 H3R probably benign Het
Ctxn1 A G 8: 4,258,553 V26A probably benign Het
Cyp27b1 A C 10: 127,051,513 T405P probably damaging Het
Cyp2c65 A G 19: 39,072,238 I181V probably benign Het
Dusp6 T A 10: 99,264,948 S269T possibly damaging Het
Efcab6 A T 15: 83,967,623 D351E probably damaging Het
Fam181a A T 12: 103,316,037 H67L possibly damaging Het
Fbxl18 A G 5: 142,886,106 L458P probably damaging Het
Flnb T C 14: 7,913,048 I1439T probably benign Het
Foxj2 C T 6: 122,838,096 Q364* probably null Het
Gm3138 A T 14: 4,250,532 N55Y probably damaging Het
Hmcn2 A G 2: 31,389,391 T1802A possibly damaging Het
Hoxc6 T C 15: 103,010,893 I187T probably damaging Het
Ighg3 T A 12: 113,357,477 I387F Het
Insr A T 8: 3,155,862 M1309K probably benign Het
Itsn1 A T 16: 91,889,209 N1290I unknown Het
Jag2 C A 12: 112,915,274 R509L probably benign Het
Kctd11 T A 11: 69,880,269 probably benign Het
Med13 C A 11: 86,272,470 V2126F probably damaging Het
Mgea5 A T 19: 45,761,182 N699K probably damaging Het
Mknk2 G A 10: 80,672,148 probably benign Het
Olfr1026 A G 2: 85,924,126 N286S probably benign Het
Olfr685 T G 7: 105,181,136 H74P probably damaging Het
Pdzrn4 T C 15: 92,677,724 V337A probably damaging Het
Pik3c3 A G 18: 30,305,029 N491D probably damaging Het
Rab37 G T 11: 115,091,933 probably null Het
Rp9 G A 9: 22,457,492 T57M probably damaging Het
Rrp12 A G 19: 41,863,274 V1274A probably damaging Het
Serpinb11 G A 1: 107,370,789 V57M probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc39a14 A T 14: 70,308,798 I392N possibly damaging Het
Sowahb G A 5: 93,044,417 Q148* probably null Het
Spon1 T C 7: 114,016,793 probably null Het
Susd4 C A 1: 182,765,183 T48K possibly damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tas2r139 T A 6: 42,141,220 N95K probably benign Het
Tle3 T C 9: 61,374,559 M57T probably benign Het
Usp13 T A 3: 32,931,703 M815K probably damaging Het
Vps8 A G 16: 21,521,894 D796G probably damaging Het
Wnk1 C T 6: 119,932,714 G41S probably damaging Het
Zfp867 A G 11: 59,464,240 S88P probably benign Het
Other mutations in Pla2g12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Pla2g12b APN 10 59416417 missense probably benign 0.28
IGL02526:Pla2g12b APN 10 59416453 missense probably damaging 1.00
IGL02551:Pla2g12b APN 10 59403870 missense probably damaging 1.00
florissant UTSW 10 59421441 unclassified probably benign
R0800:Pla2g12b UTSW 10 59403820 missense probably benign 0.00
R0918:Pla2g12b UTSW 10 59421484 missense probably damaging 0.98
R1412:Pla2g12b UTSW 10 59403982 critical splice donor site probably null
R1602:Pla2g12b UTSW 10 59421553 splice site probably null
R3765:Pla2g12b UTSW 10 59421501 missense probably damaging 1.00
R4822:Pla2g12b UTSW 10 59416514 critical splice donor site probably null
R5963:Pla2g12b UTSW 10 59403958 missense probably damaging 1.00
R6140:Pla2g12b UTSW 10 59421441 unclassified probably benign
R7889:Pla2g12b UTSW 10 59421240 splice site probably null
R7897:Pla2g12b UTSW 10 59410994 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGATGCCAGCAAGTGTATC -3'
(R):5'- GCTCTCTTGTCACACAGCTG -3'

Sequencing Primer
(F):5'- CAGCAAGTGTATCTGCTTTATTGGAC -3'
(R):5'- TGTCACACAGCTGTCTCTGAAAC -3'
Posted On2020-06-30