Incidental Mutation 'R8075:Jag2'
ID628981
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Namejagged 2
SynonymsSerh, D12Ggc2e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8075 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112907819-112929776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112915274 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 509 (R509L)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
Predicted Effect probably benign
Transcript: ENSMUST00000075827
AA Change: R509L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: R509L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223140
AA Change: R74L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,652,085 H69Q probably benign Het
Aif1 T A 17: 35,171,835 N87Y unknown Het
Caprin2 A T 6: 148,869,092 V468E probably benign Het
Cep68 A T 11: 20,239,335 V559D probably benign Het
Chrna4 A C 2: 181,039,066 I3S unknown Het
Cog3 T C 14: 75,730,702 Y407C probably damaging Het
Col15a1 A G 4: 47,208,359 H3R probably benign Het
Ctxn1 A G 8: 4,258,553 V26A probably benign Het
Cyp27b1 A C 10: 127,051,513 T405P probably damaging Het
Cyp2c65 A G 19: 39,072,238 I181V probably benign Het
Dusp6 T A 10: 99,264,948 S269T possibly damaging Het
Efcab6 A T 15: 83,967,623 D351E probably damaging Het
Fam181a A T 12: 103,316,037 H67L possibly damaging Het
Fbxl18 A G 5: 142,886,106 L458P probably damaging Het
Flnb T C 14: 7,913,048 I1439T probably benign Het
Foxj2 C T 6: 122,838,096 Q364* probably null Het
Gm3138 A T 14: 4,250,532 N55Y probably damaging Het
Hmcn2 A G 2: 31,389,391 T1802A possibly damaging Het
Hoxc6 T C 15: 103,010,893 I187T probably damaging Het
Ighg3 T A 12: 113,357,477 I387F Het
Insr A T 8: 3,155,862 M1309K probably benign Het
Itsn1 A T 16: 91,889,209 N1290I unknown Het
Kctd11 T A 11: 69,880,269 probably benign Het
Med13 C A 11: 86,272,470 V2126F probably damaging Het
Mgea5 A T 19: 45,761,182 N699K probably damaging Het
Mknk2 G A 10: 80,672,148 probably benign Het
Olfr1026 A G 2: 85,924,126 N286S probably benign Het
Olfr685 T G 7: 105,181,136 H74P probably damaging Het
Pdzrn4 T C 15: 92,677,724 V337A probably damaging Het
Pik3c3 A G 18: 30,305,029 N491D probably damaging Het
Pla2g12b T A 10: 59,421,452 S96T unknown Het
Rab37 G T 11: 115,091,933 probably null Het
Rp9 G A 9: 22,457,492 T57M probably damaging Het
Rrp12 A G 19: 41,863,274 V1274A probably damaging Het
Serpinb11 G A 1: 107,370,789 V57M probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc39a14 A T 14: 70,308,798 I392N possibly damaging Het
Sowahb G A 5: 93,044,417 Q148* probably null Het
Spon1 T C 7: 114,016,793 probably null Het
Susd4 C A 1: 182,765,183 T48K possibly damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tas2r139 T A 6: 42,141,220 N95K probably benign Het
Tle3 T C 9: 61,374,559 M57T probably benign Het
Usp13 T A 3: 32,931,703 M815K probably damaging Het
Vps8 A G 16: 21,521,894 D796G probably damaging Het
Wnk1 C T 6: 119,932,714 G41S probably damaging Het
Zfp867 A G 11: 59,464,240 S88P probably benign Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGACCCATGATGTCCACAC -3'
(R):5'- GACATCAACGATTGCCATGGG -3'

Sequencing Primer
(F):5'- TCTGCACGGTCCCATACAG -3'
(R):5'- CATGGGCAGTGTCAGCATG -3'
Posted On2020-06-30