Mutagenetix > Incidental Mutation

Incidental Mutation 'R8075:Jag2'

628981

Institutional Source

Beutler Lab

Gene Symbol

Jag2

Ensembl Gene

ENSMUSG00000002799

Gene Name

jagged 2

Synonyms

Serh, D12Ggc2e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8075 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112907819-112929776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 112915274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 509 (R509L)

Ref Sequence

ENSEMBL: ENSMUSP00000075224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075827]

AlphaFold

Q9QYE5

Predicted Effect

probably benign
Transcript: ENSMUST00000075827
AA Change: R509L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: R509L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:MNNL	26	105	4.2e-31	PFAM
low complexity region	108	123	N/A	INTRINSIC
DSL	178	240	1.48e-36	SMART
EGF_like	244	274	7.23e1	SMART
EGF	275	305	4.56e0	SMART
EGF_CA	307	345	8.5e-9	SMART
EGF	350	383	4e-5	SMART
EGF_CA	385	421	5.39e-11	SMART
EGF_CA	423	459	3.51e-10	SMART
EGF_CA	461	496	1.01e-10	SMART
EGF_CA	498	534	1.17e-6	SMART
EGF_CA	536	572	6.35e-8	SMART
EGF	588	634	7.53e-1	SMART
EGF_CA	636	672	2.89e-11	SMART
EGF	677	710	3.68e-4	SMART
EGF	715	748	1.32e-5	SMART
EGF	754	787	1.34e-6	SMART
EGF_CA	789	825	2.58e-8	SMART
EGF_CA	827	863	7.23e-12	SMART
VWC	872	949	1.3e-1	SMART
low complexity region	1002	1035	N/A	INTRINSIC
transmembrane domain	1085	1107	N/A	INTRINSIC
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1170	1199	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223140
AA Change: R74L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 98.8%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	A	T	5: 121,652,085	H69Q	probably benign	Het
Aif1	T	A	17: 35,171,835	N87Y	unknown	Het
Caprin2	A	T	6: 148,869,092	V468E	probably benign	Het
Cep68	A	T	11: 20,239,335	V559D	probably benign	Het
Chrna4	A	C	2: 181,039,066	I3S	unknown	Het
Cog3	T	C	14: 75,730,702	Y407C	probably damaging	Het
Col15a1	A	G	4: 47,208,359	H3R	probably benign	Het
Ctxn1	A	G	8: 4,258,553	V26A	probably benign	Het
Cyp27b1	A	C	10: 127,051,513	T405P	probably damaging	Het
Cyp2c65	A	G	19: 39,072,238	I181V	probably benign	Het
Dusp6	T	A	10: 99,264,948	S269T	possibly damaging	Het
Efcab6	A	T	15: 83,967,623	D351E	probably damaging	Het
Fam181a	A	T	12: 103,316,037	H67L	possibly damaging	Het
Fbxl18	A	G	5: 142,886,106	L458P	probably damaging	Het
Flnb	T	C	14: 7,913,048	I1439T	probably benign	Het
Foxj2	C	T	6: 122,838,096	Q364*	probably null	Het
Gm3138	A	T	14: 4,250,532	N55Y	probably damaging	Het
Hmcn2	A	G	2: 31,389,391	T1802A	possibly damaging	Het
Hoxc6	T	C	15: 103,010,893	I187T	probably damaging	Het
Ighg3	T	A	12: 113,357,477	I387F		Het
Insr	A	T	8: 3,155,862	M1309K	probably benign	Het
Itsn1	A	T	16: 91,889,209	N1290I	unknown	Het
Kctd11	T	A	11: 69,880,269		probably benign	Het
Med13	C	A	11: 86,272,470	V2126F	probably damaging	Het
Mgea5	A	T	19: 45,761,182	N699K	probably damaging	Het
Mknk2	G	A	10: 80,672,148		probably benign	Het
Olfr1026	A	G	2: 85,924,126	N286S	probably benign	Het
Olfr685	T	G	7: 105,181,136	H74P	probably damaging	Het
Pdzrn4	T	C	15: 92,677,724	V337A	probably damaging	Het
Pik3c3	A	G	18: 30,305,029	N491D	probably damaging	Het
Pla2g12b	T	A	10: 59,421,452	S96T	unknown	Het
Rab37	G	T	11: 115,091,933		probably null	Het
Rp9	G	A	9: 22,457,492	T57M	probably damaging	Het
Rrp12	A	G	19: 41,863,274	V1274A	probably damaging	Het
Serpinb11	G	A	1: 107,370,789	V57M	probably damaging	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc39a14	A	T	14: 70,308,798	I392N	possibly damaging	Het
Sowahb	G	A	5: 93,044,417	Q148*	probably null	Het
Spon1	T	C	7: 114,016,793		probably null	Het
Susd4	C	A	1: 182,765,183	T48K	possibly damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tas2r139	T	A	6: 42,141,220	N95K	probably benign	Het
Tle3	T	C	9: 61,374,559	M57T	probably benign	Het
Usp13	T	A	3: 32,931,703	M815K	probably damaging	Het
Vps8	A	G	16: 21,521,894	D796G	probably damaging	Het
Wnk1	C	T	6: 119,932,714	G41S	probably damaging	Het
Zfp867	A	G	11: 59,464,240	S88P	probably benign	Het

Other mutations in Jag2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Jag2	APN	12	112912718	missense	probably benign	0.20
IGL00954:Jag2	APN	12	112920406	missense	possibly damaging	0.50
IGL01532:Jag2	APN	12	112914363	missense	probably damaging	0.98
IGL01646:Jag2	APN	12	112916349	missense	possibly damaging	0.65
IGL02243:Jag2	APN	12	112916345	missense	possibly damaging	0.94
IGL02447:Jag2	APN	12	112912612	missense	probably damaging	1.00
IGL02458:Jag2	APN	12	112915993	missense	probably damaging	0.98
IGL02516:Jag2	APN	12	112910566	missense	probably damaging	1.00
IGL02574:Jag2	APN	12	112915511	missense	probably benign	0.32
IGL02629:Jag2	APN	12	112914514	splice site	probably benign
IGL02873:Jag2	APN	12	112910502	missense	probably benign	0.00
IGL03087:Jag2	APN	12	112913948	missense	possibly damaging	0.60
Jaguarundi	UTSW	12	112915469	critical splice donor site	probably null
R0068:Jag2	UTSW	12	112915193	splice site	probably benign
R0310:Jag2	UTSW	12	112913377	unclassified	probably benign
R0963:Jag2	UTSW	12	112915314	missense	probably damaging	1.00
R1188:Jag2	UTSW	12	112920121	nonsense	probably null
R1256:Jag2	UTSW	12	112914419	missense	possibly damaging	0.50
R1298:Jag2	UTSW	12	112916319	unclassified	probably benign
R1317:Jag2	UTSW	12	112914501	missense	probably benign
R2079:Jag2	UTSW	12	112920377	missense	probably damaging	1.00
R2345:Jag2	UTSW	12	112909064	missense	probably damaging	1.00
R4654:Jag2	UTSW	12	112913646	missense	probably benign	0.13
R4782:Jag2	UTSW	12	112914249	missense	probably benign
R4798:Jag2	UTSW	12	112916632	missense	probably benign	0.01
R5242:Jag2	UTSW	12	112916866	missense	probably damaging	0.97
R5350:Jag2	UTSW	12	112908922	missense	possibly damaging	0.77
R5364:Jag2	UTSW	12	112910534	missense	probably damaging	1.00
R6129:Jag2	UTSW	12	112920349	nonsense	probably null
R6362:Jag2	UTSW	12	112920122	missense	probably damaging	0.97
R6376:Jag2	UTSW	12	112909329	missense	probably benign	0.00
R6819:Jag2	UTSW	12	112910541	missense	probably damaging	1.00
R6844:Jag2	UTSW	12	112916714	missense	probably damaging	1.00
R6968:Jag2	UTSW	12	112914258	missense	probably benign	0.10
R7514:Jag2	UTSW	12	112929052	missense	probably benign	0.19
R7663:Jag2	UTSW	12	112913666	missense	probably damaging	1.00
R7730:Jag2	UTSW	12	112922041	missense	probably damaging	1.00
R7754:Jag2	UTSW	12	112915469	critical splice donor site	probably null
R7828:Jag2	UTSW	12	112913180	missense	probably benign	0.19
R7874:Jag2	UTSW	12	112915946	missense	probably damaging	0.99
R8845:Jag2	UTSW	12	112920094	missense	probably damaging	1.00
R8876:Jag2	UTSW	12	112909637	missense	probably benign	0.00
R9117:Jag2	UTSW	12	112913659	nonsense	probably null
R9400:Jag2	UTSW	12	112911988	nonsense	probably null
R9673:Jag2	UTSW	12	112911796	nonsense	probably null
R9688:Jag2	UTSW	12	112908944	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CTTGACCCATGATGTCCACAC -3'
(R):5'- GACATCAACGATTGCCATGGG -3'

Sequencing Primer
(F):5'- TCTGCACGGTCCCATACAG -3'
(R):5'- CATGGGCAGTGTCAGCATG -3'

Posted On

2020-06-30