Mutagenetix > Incidental Mutation

Incidental Mutation 'R8075:Pdzrn4'

628988

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R8075 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92677724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 337 (V337A)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: V98A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: V98A

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: V337A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: V337A

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 98.8%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	A	T	5: 121,652,085	H69Q	probably benign	Het
Aif1	T	A	17: 35,171,835	N87Y	unknown	Het
Caprin2	A	T	6: 148,869,092	V468E	probably benign	Het
Cep68	A	T	11: 20,239,335	V559D	probably benign	Het
Chrna4	A	C	2: 181,039,066	I3S	unknown	Het
Cog3	T	C	14: 75,730,702	Y407C	probably damaging	Het
Col15a1	A	G	4: 47,208,359	H3R	probably benign	Het
Ctxn1	A	G	8: 4,258,553	V26A	probably benign	Het
Cyp27b1	A	C	10: 127,051,513	T405P	probably damaging	Het
Cyp2c65	A	G	19: 39,072,238	I181V	probably benign	Het
Dusp6	T	A	10: 99,264,948	S269T	possibly damaging	Het
Efcab6	A	T	15: 83,967,623	D351E	probably damaging	Het
Fam181a	A	T	12: 103,316,037	H67L	possibly damaging	Het
Fbxl18	A	G	5: 142,886,106	L458P	probably damaging	Het
Flnb	T	C	14: 7,913,048	I1439T	probably benign	Het
Foxj2	C	T	6: 122,838,096	Q364*	probably null	Het
Gm3138	A	T	14: 4,250,532	N55Y	probably damaging	Het
Hmcn2	A	G	2: 31,389,391	T1802A	possibly damaging	Het
Hoxc6	T	C	15: 103,010,893	I187T	probably damaging	Het
Ighg3	T	A	12: 113,357,477	I387F		Het
Insr	A	T	8: 3,155,862	M1309K	probably benign	Het
Itsn1	A	T	16: 91,889,209	N1290I	unknown	Het
Jag2	C	A	12: 112,915,274	R509L	probably benign	Het
Kctd11	T	A	11: 69,880,269		probably benign	Het
Med13	C	A	11: 86,272,470	V2126F	probably damaging	Het
Mgea5	A	T	19: 45,761,182	N699K	probably damaging	Het
Mknk2	G	A	10: 80,672,148		probably benign	Het
Olfr1026	A	G	2: 85,924,126	N286S	probably benign	Het
Olfr685	T	G	7: 105,181,136	H74P	probably damaging	Het
Pik3c3	A	G	18: 30,305,029	N491D	probably damaging	Het
Pla2g12b	T	A	10: 59,421,452	S96T	unknown	Het
Rab37	G	T	11: 115,091,933		probably null	Het
Rp9	G	A	9: 22,457,492	T57M	probably damaging	Het
Rrp12	A	G	19: 41,863,274	V1274A	probably damaging	Het
Serpinb11	G	A	1: 107,370,789	V57M	probably damaging	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc39a14	A	T	14: 70,308,798	I392N	possibly damaging	Het
Sowahb	G	A	5: 93,044,417	Q148*	probably null	Het
Spon1	T	C	7: 114,016,793		probably null	Het
Susd4	C	A	1: 182,765,183	T48K	possibly damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tas2r139	T	A	6: 42,141,220	N95K	probably benign	Het
Tle3	T	C	9: 61,374,559	M57T	probably benign	Het
Usp13	T	A	3: 32,931,703	M815K	probably damaging	Het
Vps8	A	G	16: 21,521,894	D796G	probably damaging	Het
Wnk1	C	T	6: 119,932,714	G41S	probably damaging	Het
Zfp867	A	G	11: 59,464,240	S88P	probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTTCGAACTGCCAAGGAGCC -3'
(R):5'- GCTAGTTGTATAGCCAAGAGGG -3'

Sequencing Primer
(F):5'- CCCATAGTGGTACAGGTGTTAAGGC -3'
(R):5'- GCTGAGAACTAATTGAAAGCACAC -3'

Posted On

2020-06-30