Incidental Mutation 'R8075:Mgea5'
ID628997
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Namemeningioma expressed antigen 5 (hyaluronidase)
Synonyms2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8075 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location45750261-45783520 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45761182 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 699 (N699K)
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
Predicted Effect probably damaging
Transcript: ENSMUST00000026243
AA Change: N699K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: N699K

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,652,085 H69Q probably benign Het
Aif1 T A 17: 35,171,835 N87Y unknown Het
Caprin2 A T 6: 148,869,092 V468E probably benign Het
Cep68 A T 11: 20,239,335 V559D probably benign Het
Chrna4 A C 2: 181,039,066 I3S unknown Het
Cog3 T C 14: 75,730,702 Y407C probably damaging Het
Col15a1 A G 4: 47,208,359 H3R probably benign Het
Ctxn1 A G 8: 4,258,553 V26A probably benign Het
Cyp27b1 A C 10: 127,051,513 T405P probably damaging Het
Cyp2c65 A G 19: 39,072,238 I181V probably benign Het
Dusp6 T A 10: 99,264,948 S269T possibly damaging Het
Efcab6 A T 15: 83,967,623 D351E probably damaging Het
Fam181a A T 12: 103,316,037 H67L possibly damaging Het
Fbxl18 A G 5: 142,886,106 L458P probably damaging Het
Flnb T C 14: 7,913,048 I1439T probably benign Het
Foxj2 C T 6: 122,838,096 Q364* probably null Het
Gm3138 A T 14: 4,250,532 N55Y probably damaging Het
Hmcn2 A G 2: 31,389,391 T1802A possibly damaging Het
Hoxc6 T C 15: 103,010,893 I187T probably damaging Het
Ighg3 T A 12: 113,357,477 I387F Het
Insr A T 8: 3,155,862 M1309K probably benign Het
Itsn1 A T 16: 91,889,209 N1290I unknown Het
Jag2 C A 12: 112,915,274 R509L probably benign Het
Kctd11 T A 11: 69,880,269 probably benign Het
Med13 C A 11: 86,272,470 V2126F probably damaging Het
Mknk2 G A 10: 80,672,148 probably benign Het
Olfr1026 A G 2: 85,924,126 N286S probably benign Het
Olfr685 T G 7: 105,181,136 H74P probably damaging Het
Pdzrn4 T C 15: 92,677,724 V337A probably damaging Het
Pik3c3 A G 18: 30,305,029 N491D probably damaging Het
Pla2g12b T A 10: 59,421,452 S96T unknown Het
Rab37 G T 11: 115,091,933 probably null Het
Rp9 G A 9: 22,457,492 T57M probably damaging Het
Rrp12 A G 19: 41,863,274 V1274A probably damaging Het
Serpinb11 G A 1: 107,370,789 V57M probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc39a14 A T 14: 70,308,798 I392N possibly damaging Het
Sowahb G A 5: 93,044,417 Q148* probably null Het
Spon1 T C 7: 114,016,793 probably null Het
Susd4 C A 1: 182,765,183 T48K possibly damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tas2r139 T A 6: 42,141,220 N95K probably benign Het
Tle3 T C 9: 61,374,559 M57T probably benign Het
Usp13 T A 3: 32,931,703 M815K probably damaging Het
Vps8 A G 16: 21,521,894 D796G probably damaging Het
Wnk1 C T 6: 119,932,714 G41S probably damaging Het
Zfp867 A G 11: 59,464,240 S88P probably benign Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R0863:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5377:Mgea5 UTSW 19 45758022 nonsense probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6410:Mgea5 UTSW 19 45776045 splice site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
R7340:Mgea5 UTSW 19 45767456 nonsense probably null
R7437:Mgea5 UTSW 19 45778607 missense possibly damaging 0.76
R7490:Mgea5 UTSW 19 45767447 nonsense probably null
R7741:Mgea5 UTSW 19 45776062 missense probably damaging 1.00
R7823:Mgea5 UTSW 19 45776915 missense possibly damaging 0.51
R8017:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8019:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8066:Mgea5 UTSW 19 45771852 missense probably damaging 0.99
R8172:Mgea5 UTSW 19 45776900 missense probably damaging 0.99
R8558:Mgea5 UTSW 19 45758072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTCATTTCAGACAGAAGCAATTC -3'
(R):5'- GGGTAATTTCTATTCTGAAACCCC -3'

Sequencing Primer
(F):5'- CTTTCAGCCATCTAGTTCAAAGGG -3'
(R):5'- CCCCCAGGAAAGAGGCATTATATTAG -3'
Posted On2020-06-30