Incidental Mutation 'R0698:Necab1'
ID62900
Institutional Source Beutler Lab
Gene Symbol Necab1
Ensembl Gene ENSMUSG00000040536
Gene NameN-terminal EF-hand calcium binding protein 1
Synonyms1700003H21Rik, Efcbp1, NECAB1, STIP-1
MMRRC Submission 038882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R0698 (G1)
Quality Score134
Status Not validated
Chromosome4
Chromosomal Location14952245-15149794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15005041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 141 (N141S)
Ref Sequence ENSEMBL: ENSMUSP00000103908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041606] [ENSMUST00000108273]
Predicted Effect probably benign
Transcript: ENSMUST00000041606
AA Change: N141S

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038165
Gene: ENSMUSG00000040536
AA Change: N141S

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108273
AA Change: N141S

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103908
Gene: ENSMUSG00000040536
AA Change: N141S

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 C T 16: 35,290,082 T873M possibly damaging Het
Ap4e1 G A 2: 127,063,363 E985K probably benign Het
Arhgap18 T C 10: 26,912,629 I579T probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Atm T C 9: 53,515,239 E573G probably damaging Het
Baz1b T C 5: 135,198,221 V92A probably damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Cpne4 T C 9: 104,925,795 S213P probably damaging Het
Dock10 T A 1: 80,530,178 Q1672L probably damaging Het
Grm8 C T 6: 27,363,914 C534Y probably damaging Het
Ints7 A G 1: 191,594,464 M183V probably damaging Het
Invs T G 4: 48,396,364 S346A probably benign Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Lrrtm4 T C 6: 80,022,928 L441P probably damaging Het
Map4 C T 9: 110,068,788 R81* probably null Het
Med1 A G 11: 98,155,689 probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Pcdhb2 A T 18: 37,297,366 E797D probably benign Het
Pclo T C 5: 14,712,516 Y3668H unknown Het
Peg10 T A 6: 4,756,835 probably benign Het
Psd2 A G 18: 36,012,711 I723V probably benign Het
Ptprn2 C T 12: 116,722,130 R70* probably null Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab13 C T 3: 90,224,736 T69M probably damaging Het
Rpl32 T C 6: 115,805,590 N126S probably benign Het
Sis C A 3: 72,910,498 A1461S probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Spta1 T C 1: 174,181,104 L258P probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tet2 A T 3: 133,467,384 S1706T probably benign Het
Ttc6 G A 12: 57,673,216 V858I probably benign Het
Vps13c C A 9: 67,889,723 A464E probably benign Het
Zbtb17 T C 4: 141,466,096 probably null Het
Zcchc11 T A 4: 108,555,533 M1477K probably benign Het
Zcwpw1 G A 5: 137,817,521 E429K probably benign Het
Other mutations in Necab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Necab1 APN 4 15052656 missense probably damaging 1.00
IGL01314:Necab1 APN 4 15005079 missense probably damaging 0.96
IGL01751:Necab1 APN 4 14978171 missense probably damaging 1.00
IGL02098:Necab1 APN 4 14955892 utr 3 prime probably benign
IGL02381:Necab1 APN 4 15148812 splice site probably null
IGL03247:Necab1 APN 4 14960046 missense probably benign
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0321:Necab1 UTSW 4 14960083 missense probably damaging 0.99
R1125:Necab1 UTSW 4 15111257 missense probably damaging 1.00
R1251:Necab1 UTSW 4 15111192 critical splice donor site probably null
R1400:Necab1 UTSW 4 14975185 missense possibly damaging 0.71
R1505:Necab1 UTSW 4 14960047 missense probably benign 0.26
R1771:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R1776:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R2080:Necab1 UTSW 4 15140219 splice site probably benign
R4705:Necab1 UTSW 4 15052628 missense probably damaging 1.00
R4780:Necab1 UTSW 4 14989248 missense probably benign 0.18
R4795:Necab1 UTSW 4 15111208 missense possibly damaging 0.84
R4972:Necab1 UTSW 4 14978216 missense probably damaging 1.00
R5009:Necab1 UTSW 4 14947503 unclassified probably benign
R6102:Necab1 UTSW 4 14989211 missense probably benign 0.05
R6968:Necab1 UTSW 4 14957852 missense probably damaging 1.00
R7458:Necab1 UTSW 4 15111244 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACCGATTTTGAAGACCAGAACATGGG -3'
(R):5'- ATTCGGCCTCTAGCAGGTGGAAAG -3'

Sequencing Primer
(F):5'- GGGATTAAATTCCACTGTGCC -3'
(R):5'- CTCTAGCAGGTGGAAAGTCCTTC -3'
Posted On2013-07-30