Incidental Mutation 'R8076:Pck1'
ID629006
Institutional Source Beutler Lab
Gene Symbol Pck1
Ensembl Gene ENSMUSG00000027513
Gene Namephosphoenolpyruvate carboxykinase 1, cytosolic
SynonymsPEPCK, Pck-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8076 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location173153048-173159273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173155278 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 238 (N238D)
Ref Sequence ENSEMBL: ENSMUSP00000029017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029017]
Predicted Effect probably damaging
Transcript: ENSMUST00000029017
AA Change: N238D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029017
Gene: ENSMUSG00000027513
AA Change: N238D

DomainStartEndE-ValueType
Pfam:PEPCK 29 619 3.2e-275 PFAM
Meta Mutation Damage Score 0.8997 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a main control point for the regulation of gluconeogenesis. The cytosolic enzyme encoded by this gene, along with GTP, catalyzes the formation of phosphoenolpyruvate from oxaloacetate, with the release of carbon dioxide and GDP. The expression of this gene can be regulated by insulin, glucocorticoids, glucagon, cAMP, and diet. Defects in this gene are a cause of cytosolic phosphoenolpyruvate carboxykinase deficiency. A mitochondrial isozyme of the encoded protein also has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early postnatal lethality, decreased body fat, decreased glycogen levels in the liver, and altered blood chemistry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,686 Y163* probably null Het
5330417C22Rik G T 3: 108,492,082 T64K probably benign Het
Adam9 T A 8: 24,962,922 R790* probably null Het
Adamts13 C A 2: 26,990,612 P736T probably benign Het
Aldh3b2 T A 19: 3,978,859 F176L possibly damaging Het
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arid4b A T 13: 14,186,950 E753D probably benign Het
Cd160 T A 3: 96,802,346 T158S probably benign Het
Cd209g T A 8: 4,135,195 M1K probably null Het
Chrm4 A G 2: 91,927,859 Y204C probably damaging Het
Cyld T A 8: 88,729,718 N465K probably benign Het
Dchs1 A G 7: 105,761,982 V1612A probably damaging Het
Dchs1 A T 7: 105,755,921 H2471Q possibly damaging Het
Ddx24 A G 12: 103,416,218 V702A probably damaging Het
Dnah8 A G 17: 30,784,153 T3609A possibly damaging Het
Dock5 A T 14: 67,802,977 probably null Het
Dpy19l2 C T 9: 24,680,692 R205H probably damaging Het
Eif3a A T 19: 60,773,925 D473E probably damaging Het
Elobl T C 11: 88,964,970 E89G possibly damaging Het
Fam186a A T 15: 99,943,470 I1631N possibly damaging Het
Fbn2 C T 18: 58,026,424 W2411* probably null Het
Fbxl17 A G 17: 63,060,365 I671T probably damaging Het
Glul C T 1: 153,907,122 T193I possibly damaging Het
Grm7 A G 6: 111,566,039 Y907C probably damaging Het
Hist4h4 A G 6: 136,804,126 M85T probably benign Het
Hr A G 14: 70,557,941 T309A probably benign Het
Ighg3 A G 12: 113,360,538 S110P probably benign Het
Llgl2 A G 11: 115,846,929 E180G possibly damaging Het
Mat2b A T 11: 40,685,265 L112Q probably damaging Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mmp24 C A 2: 155,807,561 Y299* probably null Het
Mtor T C 4: 148,525,803 probably null Het
Olfr1123 A T 2: 87,418,545 I164L probably benign Het
Olig2 C A 16: 91,226,411 D4E probably damaging Het
Pard3 T C 8: 127,415,596 S878P probably damaging Het
Pcgf5 C T 19: 36,440,083 P137L probably damaging Het
Pstpip1 T C 9: 56,127,780 S346P probably benign Het
Qsox2 G A 2: 26,224,885 H40Y possibly damaging Het
Rbpj T C 5: 53,642,137 I129T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 G A 7: 46,710,607 P9L probably benign Het
Sema3c A G 5: 17,727,364 I622V probably benign Het
Sigirr C T 7: 141,091,872 V333M probably benign Het
Sort1 T C 3: 108,338,867 S387P probably damaging Het
Spta1 T A 1: 174,187,231 S426T probably benign Het
Stag3 G A 5: 138,283,142 S124N probably damaging Het
Stard10 A G 7: 101,343,969 Y244C probably damaging Het
Tcea3 T A 4: 136,268,129 I261N probably damaging Het
Tdrd1 A G 19: 56,843,835 K395E probably damaging Het
Tenm2 T A 11: 36,027,221 D1905V probably benign Het
Trim12c T C 7: 104,340,830 Y480C unknown Het
Trip11 A G 12: 101,883,482 V1441A probably damaging Het
Ttc21a G A 9: 119,966,326 R1107Q probably benign Het
Wdr41 A G 13: 95,017,330 I296V probably benign Het
Zdbf2 T A 1: 63,306,101 V1213E possibly damaging Het
Zfp37 T C 4: 62,191,316 N545D possibly damaging Het
Other mutations in Pck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Pck1 APN 2 173154118 critical splice donor site probably null
IGL00817:Pck1 APN 2 173153432 missense possibly damaging 0.47
IGL02476:Pck1 APN 2 173158282 missense probably benign
IGL02803:Pck1 APN 2 173156004 missense probably damaging 1.00
IGL02874:Pck1 APN 2 173155249 missense probably damaging 1.00
IGL02886:Pck1 APN 2 173154856 missense probably benign 0.43
Limestone UTSW 2 173158560 missense probably damaging 1.00
limpet UTSW 2 173154012 missense probably damaging 0.99
R0041:Pck1 UTSW 2 173155210 missense probably benign 0.21
R0125:Pck1 UTSW 2 173156081 nonsense probably null
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0373:Pck1 UTSW 2 173153390 start codon destroyed probably null 0.99
R0595:Pck1 UTSW 2 173157029 missense probably damaging 1.00
R1338:Pck1 UTSW 2 173158410 missense probably benign 0.18
R1623:Pck1 UTSW 2 173154718 missense probably benign 0.26
R1752:Pck1 UTSW 2 173157113 missense probably benign 0.00
R2107:Pck1 UTSW 2 173154068 missense probably benign 0.00
R2376:Pck1 UTSW 2 173157116 missense probably benign
R2883:Pck1 UTSW 2 173158575 missense probably benign 0.03
R3508:Pck1 UTSW 2 173158384 missense possibly damaging 0.61
R4718:Pck1 UTSW 2 173155221 missense probably damaging 0.99
R4853:Pck1 UTSW 2 173154714 nonsense probably null
R4907:Pck1 UTSW 2 173157023 missense probably damaging 1.00
R4950:Pck1 UTSW 2 173154827 missense probably benign
R5073:Pck1 UTSW 2 173156977 missense probably benign 0.41
R5134:Pck1 UTSW 2 173153489 missense probably benign 0.23
R5213:Pck1 UTSW 2 173156085 nonsense probably null
R5244:Pck1 UTSW 2 173154863 missense possibly damaging 0.91
R5654:Pck1 UTSW 2 173158560 missense probably damaging 1.00
R5831:Pck1 UTSW 2 173156999 missense probably damaging 1.00
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6143:Pck1 UTSW 2 173154012 missense probably damaging 0.99
R6276:Pck1 UTSW 2 173157319 missense probably damaging 1.00
R7553:Pck1 UTSW 2 173157067 missense probably benign 0.13
R7860:Pck1 UTSW 2 173155950 missense possibly damaging 0.80
R8187:Pck1 UTSW 2 173155240 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTTTCCAGATCGAAGGTGGAGG -3'
(R):5'- CCTCAAGTCCCCAGATGTTG -3'

Sequencing Primer
(F):5'- GAGAACCAGAAGTTTCAGGTCCTTC -3'
(R):5'- CAAATTTCCTCCCAGGGT -3'
Posted On2020-06-30