Incidental Mutation 'R8076:Cd160'
ID629007
Institutional Source Beutler Lab
Gene Symbol Cd160
Ensembl Gene ENSMUSG00000038304
Gene NameCD160 antigen
SynonymsBy55
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8076 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96798763-96829351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96802346 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 158 (T158S)
Ref Sequence ENSEMBL: ENSMUSP00000037466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047702] [ENSMUST00000107074] [ENSMUST00000165991]
Predicted Effect probably benign
Transcript: ENSMUST00000047702
AA Change: T158S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037466
Gene: ENSMUSG00000038304
AA Change: T158S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 32 136 3.85e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107074
AA Change: T158S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102689
Gene: ENSMUSG00000038304
AA Change: T158S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 32 136 3.85e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165991
SMART Domains Protein: ENSMUSP00000132363
Gene: ENSMUSG00000038304

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 32 136 1.5e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD160 is an 27 kDa glycoprotein which was initially identified with the monoclonal antibody BY55. Its expression is tightly associated with peripheral blood NK cells and CD8 T lymphocytes with cytolytic effector activity. The cDNA sequence of CD160 predicts a cysteine-rich, glycosylphosphatidylinositol-anchored protein of 181 amino acids with a single Ig-like domain weakly homologous to KIR2DL4 molecule. CD160 is expressed at the cell surface as a tightly disulfide-linked multimer. RNA blot analysis revealed CD160 mRNAs of 1.5 and 1.6 kb whose expression was highly restricted to circulating NK and T cells, spleen and small intestine. Within NK cells CD160 is expressed by CD56dimCD16+ cells whereas among circulating T cells its expression is mainly restricted to TCRgd bearing cells and to TCRab+CD8brightCD95+CD56+CD28-CD27-cells. In tissues, CD160 is expressed on all intestinal intraepithelial lymphocytes. CD160 shows a broad specificity for binding to both classical and nonclassical MHC class I molecules. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased interferon-gamma secretion by NK cells and increased tumor growth/size following inoculation with NK-dependent B16 tumor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,686 Y163* probably null Het
5330417C22Rik G T 3: 108,492,082 T64K probably benign Het
Adam9 T A 8: 24,962,922 R790* probably null Het
Adamts13 C A 2: 26,990,612 P736T probably benign Het
Aldh3b2 T A 19: 3,978,859 F176L possibly damaging Het
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arid4b A T 13: 14,186,950 E753D probably benign Het
Cd209g T A 8: 4,135,195 M1K probably null Het
Chrm4 A G 2: 91,927,859 Y204C probably damaging Het
Cyld T A 8: 88,729,718 N465K probably benign Het
Dchs1 A T 7: 105,755,921 H2471Q possibly damaging Het
Dchs1 A G 7: 105,761,982 V1612A probably damaging Het
Ddx24 A G 12: 103,416,218 V702A probably damaging Het
Dnah8 A G 17: 30,784,153 T3609A possibly damaging Het
Dpy19l2 C T 9: 24,680,692 R205H probably damaging Het
Eif3a A T 19: 60,773,925 D473E probably damaging Het
Elobl T C 11: 88,964,970 E89G possibly damaging Het
Fam186a A T 15: 99,943,470 I1631N possibly damaging Het
Fbn2 C T 18: 58,026,424 W2411* probably null Het
Fbxl17 A G 17: 63,060,365 I671T probably damaging Het
Glul C T 1: 153,907,122 T193I possibly damaging Het
Grm7 A G 6: 111,566,039 Y907C probably damaging Het
Hist4h4 A G 6: 136,804,126 M85T probably benign Het
Hr A G 14: 70,557,941 T309A probably benign Het
Ighg3 A G 12: 113,360,538 S110P probably benign Het
Llgl2 A G 11: 115,846,929 E180G possibly damaging Het
Mat2b A T 11: 40,685,265 L112Q probably damaging Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mmp24 C A 2: 155,807,561 Y299* probably null Het
Mtor T C 4: 148,525,803 probably null Het
Olfr1123 A T 2: 87,418,545 I164L probably benign Het
Olig2 C A 16: 91,226,411 D4E probably damaging Het
Pard3 T C 8: 127,415,596 S878P probably damaging Het
Pcgf5 C T 19: 36,440,083 P137L probably damaging Het
Pck1 A G 2: 173,155,278 N238D probably damaging Het
Pstpip1 T C 9: 56,127,780 S346P probably benign Het
Qsox2 G A 2: 26,224,885 H40Y possibly damaging Het
Rbpj T C 5: 53,642,137 I129T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 G A 7: 46,710,607 P9L probably benign Het
Sema3c A G 5: 17,727,364 I622V probably benign Het
Sigirr C T 7: 141,091,872 V333M probably benign Het
Sort1 T C 3: 108,338,867 S387P probably damaging Het
Spta1 T A 1: 174,187,231 S426T probably benign Het
Stag3 G A 5: 138,283,142 S124N probably damaging Het
Stard10 A G 7: 101,343,969 Y244C probably damaging Het
Tcea3 T A 4: 136,268,129 I261N probably damaging Het
Tdrd1 A G 19: 56,843,835 K395E probably damaging Het
Tenm2 T A 11: 36,027,221 D1905V probably benign Het
Trim12c T C 7: 104,340,830 Y480C unknown Het
Trip11 A G 12: 101,883,482 V1441A probably damaging Het
Ttc21a G A 9: 119,966,326 R1107Q probably benign Het
Wdr41 A G 13: 95,017,330 I296V probably benign Het
Zdbf2 T A 1: 63,306,101 V1213E possibly damaging Het
Zfp37 T C 4: 62,191,316 N545D possibly damaging Het
Other mutations in Cd160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Cd160 APN 3 96805570 missense possibly damaging 0.52
IGL02119:Cd160 APN 3 96808823 missense possibly damaging 0.96
IGL02306:Cd160 APN 3 96808823 missense possibly damaging 0.96
IGL02642:Cd160 APN 3 96800611 missense probably benign 0.01
IGL03056:Cd160 APN 3 96805811 missense probably benign 0.06
IGL03327:Cd160 APN 3 96805533 splice site probably null
R0690:Cd160 UTSW 3 96805786 missense probably damaging 0.99
R1099:Cd160 UTSW 3 96805840 missense probably damaging 0.99
R5669:Cd160 UTSW 3 96808898 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGACTTTAATACCGTAAAACCAGTG -3'
(R):5'- AAGCTGCCTGGCCTTCTTTG -3'

Sequencing Primer
(F):5'- GTCACCCACATACTGGTTAGCATG -3'
(R):5'- GCCTGGCCTTCTTTGAGGTTAC -3'
Posted On2020-06-30