Incidental Mutation 'R8076:Trim12c'
ID629022
Institutional Source Beutler Lab
Gene Symbol Trim12c
Ensembl Gene ENSMUSG00000057143
Gene Nametripartite motif-containing 12C
SynonymsTrim12-2, 9230105E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8076 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104338754-104353362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104340830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 480 (Y480C)
Ref Sequence ENSEMBL: ENSMUSP00000060100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106847] [ENSMUST00000130139] [ENSMUST00000180136]
Predicted Effect unknown
Transcript: ENSMUST00000059037
AA Change: Y480C
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143
AA Change: Y480C

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106847
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130139
AA Change: Y480C
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143
AA Change: Y480C

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180136
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,686 Y163* probably null Het
5330417C22Rik G T 3: 108,492,082 T64K probably benign Het
Adam9 T A 8: 24,962,922 R790* probably null Het
Adamts13 C A 2: 26,990,612 P736T probably benign Het
Aldh3b2 T A 19: 3,978,859 F176L possibly damaging Het
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arid4b A T 13: 14,186,950 E753D probably benign Het
Cd160 T A 3: 96,802,346 T158S probably benign Het
Cd209g T A 8: 4,135,195 M1K probably null Het
Chrm4 A G 2: 91,927,859 Y204C probably damaging Het
Cyld T A 8: 88,729,718 N465K probably benign Het
Dchs1 A G 7: 105,761,982 V1612A probably damaging Het
Dchs1 A T 7: 105,755,921 H2471Q possibly damaging Het
Ddx24 A G 12: 103,416,218 V702A probably damaging Het
Dnah8 A G 17: 30,784,153 T3609A possibly damaging Het
Dock5 A T 14: 67,802,977 probably null Het
Dpy19l2 C T 9: 24,680,692 R205H probably damaging Het
Eif3a A T 19: 60,773,925 D473E probably damaging Het
Elobl T C 11: 88,964,970 E89G possibly damaging Het
Fam186a A T 15: 99,943,470 I1631N possibly damaging Het
Fbn2 C T 18: 58,026,424 W2411* probably null Het
Fbxl17 A G 17: 63,060,365 I671T probably damaging Het
Glul C T 1: 153,907,122 T193I possibly damaging Het
Grm7 A G 6: 111,566,039 Y907C probably damaging Het
Hist4h4 A G 6: 136,804,126 M85T probably benign Het
Hr A G 14: 70,557,941 T309A probably benign Het
Ighg3 A G 12: 113,360,538 S110P probably benign Het
Llgl2 A G 11: 115,846,929 E180G possibly damaging Het
Mat2b A T 11: 40,685,265 L112Q probably damaging Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mmp24 C A 2: 155,807,561 Y299* probably null Het
Mtor T C 4: 148,525,803 probably null Het
Olfr1123 A T 2: 87,418,545 I164L probably benign Het
Olig2 C A 16: 91,226,411 D4E probably damaging Het
Pard3 T C 8: 127,415,596 S878P probably damaging Het
Pcgf5 C T 19: 36,440,083 P137L probably damaging Het
Pck1 A G 2: 173,155,278 N238D probably damaging Het
Pstpip1 T C 9: 56,127,780 S346P probably benign Het
Qsox2 G A 2: 26,224,885 H40Y possibly damaging Het
Rbpj T C 5: 53,642,137 I129T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 G A 7: 46,710,607 P9L probably benign Het
Sema3c A G 5: 17,727,364 I622V probably benign Het
Sigirr C T 7: 141,091,872 V333M probably benign Het
Sort1 T C 3: 108,338,867 S387P probably damaging Het
Spta1 T A 1: 174,187,231 S426T probably benign Het
Stag3 G A 5: 138,283,142 S124N probably damaging Het
Stard10 A G 7: 101,343,969 Y244C probably damaging Het
Tcea3 T A 4: 136,268,129 I261N probably damaging Het
Tdrd1 A G 19: 56,843,835 K395E probably damaging Het
Tenm2 T A 11: 36,027,221 D1905V probably benign Het
Trip11 A G 12: 101,883,482 V1441A probably damaging Het
Ttc21a G A 9: 119,966,326 R1107Q probably benign Het
Wdr41 A G 13: 95,017,330 I296V probably benign Het
Zdbf2 T A 1: 63,306,101 V1213E possibly damaging Het
Zfp37 T C 4: 62,191,316 N545D possibly damaging Het
Other mutations in Trim12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Trim12c APN 7 104348215 missense possibly damaging 0.81
IGL01645:Trim12c APN 7 104345054 nonsense probably null
IGL01737:Trim12c APN 7 104348062 missense probably damaging 1.00
IGL02184:Trim12c APN 7 104348223 missense probably benign 0.00
IGL02309:Trim12c APN 7 104344956 missense possibly damaging 0.72
IGL02323:Trim12c APN 7 104348266 missense probably benign 0.00
IGL02656:Trim12c APN 7 104341203 missense probably damaging 1.00
R0127:Trim12c UTSW 7 104340906 splice site probably null
R0554:Trim12c UTSW 7 104344962 missense probably damaging 0.96
R1480:Trim12c UTSW 7 104348244 missense probably damaging 1.00
R1501:Trim12c UTSW 7 104340888 unclassified probably benign
R2058:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R2059:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R3838:Trim12c UTSW 7 104340868 unclassified probably benign
R3870:Trim12c UTSW 7 104348337 missense probably benign 0.00
R4896:Trim12c UTSW 7 104340948 missense probably damaging 0.99
R6288:Trim12c UTSW 7 104346729 missense probably benign 0.19
R6522:Trim12c UTSW 7 104348324 missense probably benign 0.38
R6562:Trim12c UTSW 7 104345134 splice site probably null
R6801:Trim12c UTSW 7 104348130 missense probably damaging 1.00
R7016:Trim12c UTSW 7 104348206 missense
R7811:Trim12c UTSW 7 104341262 missense unknown
R8147:Trim12c UTSW 7 104341958 missense unknown
X0062:Trim12c UTSW 7 104346680 missense probably benign 0.13
Z1176:Trim12c UTSW 7 104341136 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTTGACCAAATGGGAAGTG -3'
(R):5'- TGTCCTTTCACAGGCAAGCC -3'

Sequencing Primer
(F):5'- CCTTGACCAAATGGGAAGTGATTTAC -3'
(R):5'- TTTCACAGGCAAGCCCAGTG -3'
Posted On2020-06-30