Incidental Mutation 'R8076:Trip11'
ID629039
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8076 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101883482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1441 (V1441A)
Ref Sequence ENSEMBL: ENSMUSP00000021605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183] [ENSMUST00000177536]
Predicted Effect probably damaging
Transcript: ENSMUST00000021605
AA Change: V1441A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: V1441A

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177183
AA Change: V1156A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: V1156A

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177480
AA Change: V42A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000177536
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Meta Mutation Damage Score 0.3177 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,686 Y163* probably null Het
5330417C22Rik G T 3: 108,492,082 T64K probably benign Het
Adam9 T A 8: 24,962,922 R790* probably null Het
Adamts13 C A 2: 26,990,612 P736T probably benign Het
Aldh3b2 T A 19: 3,978,859 F176L possibly damaging Het
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arid4b A T 13: 14,186,950 E753D probably benign Het
Cd160 T A 3: 96,802,346 T158S probably benign Het
Cd209g T A 8: 4,135,195 M1K probably null Het
Chrm4 A G 2: 91,927,859 Y204C probably damaging Het
Cyld T A 8: 88,729,718 N465K probably benign Het
Dchs1 A T 7: 105,755,921 H2471Q possibly damaging Het
Dchs1 A G 7: 105,761,982 V1612A probably damaging Het
Ddx24 A G 12: 103,416,218 V702A probably damaging Het
Dnah8 A G 17: 30,784,153 T3609A possibly damaging Het
Dock5 A T 14: 67,802,977 probably null Het
Dpy19l2 C T 9: 24,680,692 R205H probably damaging Het
Eif3a A T 19: 60,773,925 D473E probably damaging Het
Elobl T C 11: 88,964,970 E89G possibly damaging Het
Fam186a A T 15: 99,943,470 I1631N possibly damaging Het
Fbn2 C T 18: 58,026,424 W2411* probably null Het
Fbxl17 A G 17: 63,060,365 I671T probably damaging Het
Glul C T 1: 153,907,122 T193I possibly damaging Het
Grm7 A G 6: 111,566,039 Y907C probably damaging Het
Hist4h4 A G 6: 136,804,126 M85T probably benign Het
Hr A G 14: 70,557,941 T309A probably benign Het
Ighg3 A G 12: 113,360,538 S110P probably benign Het
Llgl2 A G 11: 115,846,929 E180G possibly damaging Het
Mat2b A T 11: 40,685,265 L112Q probably damaging Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mmp24 C A 2: 155,807,561 Y299* probably null Het
Mtor T C 4: 148,525,803 probably null Het
Olfr1123 A T 2: 87,418,545 I164L probably benign Het
Olig2 C A 16: 91,226,411 D4E probably damaging Het
Pard3 T C 8: 127,415,596 S878P probably damaging Het
Pcgf5 C T 19: 36,440,083 P137L probably damaging Het
Pck1 A G 2: 173,155,278 N238D probably damaging Het
Pstpip1 T C 9: 56,127,780 S346P probably benign Het
Qsox2 G A 2: 26,224,885 H40Y possibly damaging Het
Rbpj T C 5: 53,642,137 I129T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 G A 7: 46,710,607 P9L probably benign Het
Sema3c A G 5: 17,727,364 I622V probably benign Het
Sigirr C T 7: 141,091,872 V333M probably benign Het
Sort1 T C 3: 108,338,867 S387P probably damaging Het
Spta1 T A 1: 174,187,231 S426T probably benign Het
Stag3 G A 5: 138,283,142 S124N probably damaging Het
Stard10 A G 7: 101,343,969 Y244C probably damaging Het
Tcea3 T A 4: 136,268,129 I261N probably damaging Het
Tdrd1 A G 19: 56,843,835 K395E probably damaging Het
Tenm2 T A 11: 36,027,221 D1905V probably benign Het
Trim12c T C 7: 104,340,830 Y480C unknown Het
Ttc21a G A 9: 119,966,326 R1107Q probably benign Het
Wdr41 A G 13: 95,017,330 I296V probably benign Het
Zdbf2 T A 1: 63,306,101 V1213E possibly damaging Het
Zfp37 T C 4: 62,191,316 N545D possibly damaging Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 splice site probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
R7752:Trip11 UTSW 12 101886974 missense probably benign 0.01
R7763:Trip11 UTSW 12 101844855 missense probably benign 0.03
R7779:Trip11 UTSW 12 101883537 missense probably damaging 0.97
R7844:Trip11 UTSW 12 101878144 missense probably damaging 1.00
R8055:Trip11 UTSW 12 101837665 missense probably damaging 1.00
R8288:Trip11 UTSW 12 101894384 missense possibly damaging 0.73
R8294:Trip11 UTSW 12 101844901 missense possibly damaging 0.93
R8318:Trip11 UTSW 12 101912804 missense unknown
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAAAAGCAAGTGCCTTCTCTC -3'
(R):5'- TTGCTGCTTCCTCAGAGGTAG -3'

Sequencing Primer
(F):5'- AAAAGCAAGTGCCTTCTCTCTCATTG -3'
(R):5'- TGCTTCCTCAGAGGTAGAAAGAAAAG -3'
Posted On2020-06-30