Incidental Mutation 'R8077:Itga8'
ID629059
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Nameintegrin alpha 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location12106632-12301922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12242433 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 326 (V326I)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
Predicted Effect probably benign
Transcript: ENSMUST00000028106
AA Change: V326I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V326I

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
AA Change: V326I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: V326I

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12255966 nonsense probably null
IGL00820:Itga8 APN 2 12232892 missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12191714 missense probably benign
IGL01508:Itga8 APN 2 12232802 missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12160312 splice site probably benign
IGL01590:Itga8 APN 2 12160333 missense probably damaging 1.00
IGL01743:Itga8 APN 2 12265333 missense probably benign 0.04
IGL02634:Itga8 APN 2 12140478 missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12189480 missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12191199 missense probably benign 0.00
IGL03218:Itga8 APN 2 12111025 missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12132516 missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12230092 missense probably benign 0.19
R0196:Itga8 UTSW 2 12204729 critical splice donor site probably null
R0356:Itga8 UTSW 2 12182721 missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12232886 missense probably damaging 1.00
R0530:Itga8 UTSW 2 12191816 missense probably damaging 0.99
R0715:Itga8 UTSW 2 12191242 splice site probably benign
R0800:Itga8 UTSW 2 12193551 missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12262192 splice site probably null
R1675:Itga8 UTSW 2 12200163 missense probably damaging 0.99
R1758:Itga8 UTSW 2 12265333 missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12300846 missense probably damaging 1.00
R2187:Itga8 UTSW 2 12194420 missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12182709 missense probably benign 0.38
R2356:Itga8 UTSW 2 12200141 missense probably benign
R2371:Itga8 UTSW 2 12253466 missense probably damaging 1.00
R2412:Itga8 UTSW 2 12301715 missense probably benign
R2440:Itga8 UTSW 2 12178680 missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12160404 missense probably damaging 0.98
R3730:Itga8 UTSW 2 12193510 missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12189519 missense probably benign
R3982:Itga8 UTSW 2 12300963 missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4514:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4660:Itga8 UTSW 2 12265258 missense probably damaging 1.00
R4890:Itga8 UTSW 2 12193291 splice site probably benign
R5533:Itga8 UTSW 2 12160350 missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12265328 missense probably damaging 1.00
R5720:Itga8 UTSW 2 12111087 missense probably damaging 0.99
R5749:Itga8 UTSW 2 12262078 missense probably damaging 1.00
R5930:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12132486 missense probably damaging 0.99
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6211:Itga8 UTSW 2 12193509 missense probably damaging 1.00
R6337:Itga8 UTSW 2 12253469 nonsense probably null
R6442:Itga8 UTSW 2 12230143 missense probably benign 0.00
R6491:Itga8 UTSW 2 12204776 missense probably damaging 1.00
R6543:Itga8 UTSW 2 12301644 missense probably damaging 0.99
R6574:Itga8 UTSW 2 12230161 missense probably benign 0.17
R6760:Itga8 UTSW 2 12301640 missense probably damaging 1.00
R6858:Itga8 UTSW 2 12200081 missense probably benign 0.00
R6943:Itga8 UTSW 2 12155371 critical splice donor site probably null
R7048:Itga8 UTSW 2 12111084 missense probably damaging 0.99
R7203:Itga8 UTSW 2 12230095 missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12232901 missense probably damaging 1.00
R7323:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R7540:Itga8 UTSW 2 12111037 missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12109187 missense probably damaging 1.00
R7748:Itga8 UTSW 2 12230239 missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12191737 missense probably damaging 0.99
R8031:Itga8 UTSW 2 12155486 missense probably benign
Z1176:Itga8 UTSW 2 12247518 missense probably damaging 1.00
Z1176:Itga8 UTSW 2 12262136 missense probably benign 0.01
Z1176:Itga8 UTSW 2 12301832 start gained probably benign
Z1177:Itga8 UTSW 2 12300933 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATCCTCTTGTCCTGAACCAAAAG -3'
(R):5'- GTCCACCAACTGAATGGACC -3'

Sequencing Primer
(F):5'- CTTGTCCTGAACCAAAAGTTAAAAC -3'
(R):5'- CCTAATGTATCCAGAGGATGTACCAG -3'
Posted On2020-06-30