Mutagenetix > Incidental Mutation

Incidental Mutation 'R8077:Itga8'

629059

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R8077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12242433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 326 (V326I)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably benign
Transcript: ENSMUST00000028106
AA Change: V326I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V326I

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791
AA Change: V326I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: V326I

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 95.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,517,237	V132E	probably benign	Het
4930563M21Rik	C	T	9: 55,987,966	V315M	probably damaging	Het
9430007A20Rik	T	C	4: 144,528,556	I182T	probably benign	Het
Alb	G	C	5: 90,467,355	R242P	probably damaging	Het
Amotl1	A	T	9: 14,550,502	V805D	probably damaging	Het
Arhgef3	T	C	14: 27,385,924	L179P	probably damaging	Het
Atp8b3	G	A	10: 80,531,024	L247F	possibly damaging	Het
Ccdc191	T	C	16: 43,915,605		probably null	Het
Celsr3	A	G	9: 108,828,331	H671R	probably benign	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap97	G	T	8: 46,170,445	V291F	possibly damaging	Het
Clca2	A	G	3: 145,071,527	V861A	possibly damaging	Het
Cln8	A	T	8: 14,894,950	D88V	probably damaging	Het
Col18a1	C	A	10: 77,080,851	G330V	unknown	Het
Dis3	C	T	14: 99,090,035	R344Q	probably benign	Het
Esyt2	T	A	12: 116,342,228	S359R	possibly damaging	Het
Fbxo41	A	T	6: 85,473,229	L844Q	probably damaging	Het
Fn1	G	A	1: 71,612,602	T1372M	probably damaging	Het
Gbp5	G	A	3: 142,507,739	R472H	probably benign	Het
Gm156	A	G	6: 129,766,695	Y209H	probably benign	Het
Gm21964	C	T	8: 110,110,103	T207M	probably damaging	Het
Gm4559	C	T	7: 142,273,816	R183K	unknown	Het
Gm9507	T	A	10: 77,811,770	E25V	unknown	Het
Gm9573	TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG	TCAGTGGTGGTCAGG	17: 35,619,736		probably benign	Het
Golgb1	A	G	16: 36,918,633	I2486V	probably damaging	Het
Ifitm10	A	T	7: 142,370,967	V45D	probably damaging	Het
Ift80	A	G	3: 68,916,145	Y595H	probably benign	Het
Kif14	A	T	1: 136,471,448	H449L	possibly damaging	Het
Ldlrad1	G	A	4: 107,209,491	A8T	probably benign	Het
Lrrc8b	C	A	5: 105,480,017	S76R	possibly damaging	Het
Lrrn1	T	C	6: 107,568,822	L527P	probably damaging	Het
Luc7l	T	C	17: 26,255,073	V35A	probably damaging	Het
Luzp1	T	G	4: 136,543,091	V875G	probably damaging	Het
Mcf2l	G	T	8: 12,998,494		probably null	Het
Mcoln2	T	C	3: 146,190,414	M497T	probably damaging	Het
Mrgprb4	A	T	7: 48,198,455	S242T	probably benign	Het
Nipbl	T	A	15: 8,311,250	R1995S	possibly damaging	Het
Nup35	A	G	2: 80,638,936		probably null	Het
Olfr1394	A	G	11: 49,160,485	D157G	probably damaging	Het
Olfr420	A	G	1: 174,151,845		probably benign	Het
Olfr45	C	T	7: 140,691,133	S76F	probably benign	Het
Prdm12	A	G	2: 31,642,304	K109E	probably damaging	Het
Ptch1	A	T	13: 63,540,812	L444Q	probably damaging	Het
Qtrt1	C	T	9: 21,420,096	R374*	probably null	Het
Rnase11	T	C	14: 51,049,941	D52G	probably damaging	Het
Rps6	A	G	4: 86,855,921	S148P	probably benign	Het
Rrm2b	T	C	15: 37,946,800	K86E	possibly damaging	Het
Sh2d1b2	A	G	1: 170,248,173	K59E	possibly damaging	Het
Six6	T	A	12: 72,940,326	W91R	probably damaging	Het
Slc23a2	C	A	2: 132,089,172	A136S	possibly damaging	Het
Slc9a5	G	A	8: 105,359,380	R593H	probably damaging	Het
Smbd1	T	C	16: 32,810,434	M1V	probably null	Het
Ssbp4	T	C	8: 70,598,997	Y239C	probably damaging	Het
Stox1	T	C	10: 62,665,566	E405G	probably damaging	Het
Tmem192	A	G	8: 64,965,544	I194V	probably benign	Het
Tns3	A	T	11: 8,445,667	C1246S	probably damaging	Het
Ugt1a6a	A	T	1: 88,138,853	Q127L	probably benign	Het
Ush2a	A	G	1: 188,542,828	I1833V	probably benign	Het
Vmn2r66	A	T	7: 85,006,885	Y308N	probably benign	Het
Vti1a	T	G	19: 55,576,485	L191R	probably benign	Het
Zbtb38	A	T	9: 96,688,100	N310K	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ATCCTCTTGTCCTGAACCAAAAG -3'
(R):5'- GTCCACCAACTGAATGGACC -3'

Sequencing Primer
(F):5'- CTTGTCCTGAACCAAAAGTTAAAAC -3'
(R):5'- CCTAATGTATCCAGAGGATGTACCAG -3'

Posted On

2020-06-30