Incidental Mutation 'R8077:Ift80'
ID629062
Institutional Source Beutler Lab
Gene Symbol Ift80
Ensembl Gene ENSMUSG00000027778
Gene Nameintraflagellar transport 80
Synonyms4921524P20Rik, Wdr56
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location68892499-69004570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68916145 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 595 (Y595H)
Ref Sequence ENSEMBL: ENSMUSP00000133263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]
Predicted Effect probably benign
Transcript: ENSMUST00000029347
AA Change: Y595H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: Y595H

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107812
AA Change: Y595H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: Y595H

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169064
AA Change: Y595H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: Y595H

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Ift80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ift80 APN 3 68914653 nonsense probably null
IGL01020:Ift80 APN 3 68963679 missense probably damaging 1.00
IGL01544:Ift80 APN 3 68990782 missense probably benign 0.05
IGL01612:Ift80 APN 3 68963663 missense possibly damaging 0.61
IGL01743:Ift80 APN 3 68962296 missense probably benign 0.00
IGL02187:Ift80 APN 3 68985456 missense probably damaging 1.00
IGL02381:Ift80 APN 3 68962320 splice site probably null
IGL02407:Ift80 APN 3 68898536 missense probably benign
IGL02510:Ift80 APN 3 68898543 missense probably benign 0.07
IGL02512:Ift80 APN 3 68927725 critical splice donor site probably null
R0091:Ift80 UTSW 3 68914675 missense probably damaging 1.00
R0212:Ift80 UTSW 3 68940173 missense probably benign 0.05
R0348:Ift80 UTSW 3 68935899 missense probably benign
R0357:Ift80 UTSW 3 68914653 nonsense probably null
R1381:Ift80 UTSW 3 68914783 missense possibly damaging 0.78
R1419:Ift80 UTSW 3 68940198 missense probably damaging 1.00
R1643:Ift80 UTSW 3 68916157 missense probably benign 0.06
R1899:Ift80 UTSW 3 68918513 missense probably benign 0.00
R1926:Ift80 UTSW 3 68916165 missense probably damaging 1.00
R2013:Ift80 UTSW 3 68990784 missense possibly damaging 0.62
R3894:Ift80 UTSW 3 68917999 missense probably damaging 1.00
R4214:Ift80 UTSW 3 68990808 missense possibly damaging 0.64
R4290:Ift80 UTSW 3 68963690 missense probably damaging 0.96
R4303:Ift80 UTSW 3 68894174 missense probably benign 0.15
R4361:Ift80 UTSW 3 68963649 missense probably damaging 1.00
R4576:Ift80 UTSW 3 68950530 missense possibly damaging 0.71
R4596:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4652:Ift80 UTSW 3 68914940 missense probably benign 0.32
R4654:Ift80 UTSW 3 68918537 missense possibly damaging 0.94
R4720:Ift80 UTSW 3 68962290 missense possibly damaging 0.50
R4865:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4885:Ift80 UTSW 3 68950496 missense probably damaging 0.98
R5357:Ift80 UTSW 3 68990780 missense possibly damaging 0.62
R5561:Ift80 UTSW 3 68967863 missense probably benign 0.00
R5589:Ift80 UTSW 3 68930900 missense probably damaging 1.00
R5806:Ift80 UTSW 3 68950476 missense probably benign 0.09
R6910:Ift80 UTSW 3 68927735 missense probably benign 0.01
R6962:Ift80 UTSW 3 68994545 start gained probably benign
R7157:Ift80 UTSW 3 68990944 nonsense probably null
R7452:Ift80 UTSW 3 68994282 splice site probably null
R7504:Ift80 UTSW 3 68918005 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGCAAGCTGTCCCAGTG -3'
(R):5'- GATGCCTGTAGGGGAACAATC -3'

Sequencing Primer
(F):5'- TGTCCCAGTGTGCAGCAGAAG -3'
(R):5'- AGTGTAGTTTGCTTCAAGTGTACATC -3'
Posted On2020-06-30