Incidental Mutation 'R8077:Mcoln2'
ID629065
Institutional Source Beutler Lab
Gene Symbol Mcoln2
Ensembl Gene ENSMUSG00000011008
Gene Namemucolipin 2
Synonymsmucolipidin 2, TRPML2, 3300002C04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146149833-146195513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146190414 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 497 (M497T)
Ref Sequence ENSEMBL: ENSMUSP00000011152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011152] [ENSMUST00000098524] [ENSMUST00000170972]
Predicted Effect probably damaging
Transcript: ENSMUST00000011152
AA Change: M497T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000011152
Gene: ENSMUSG00000011008
AA Change: M497T

DomainStartEndE-ValueType
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 340 362 N/A INTRINSIC
Pfam:PKD_channel 370 513 5.8e-12 PFAM
low complexity region 546 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098524
AA Change: M469T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096125
Gene: ENSMUSG00000011008
AA Change: M469T

DomainStartEndE-ValueType
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Pfam:PKD_channel 343 485 6.9e-11 PFAM
low complexity region 518 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170972
AA Change: M17T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128900
Gene: ENSMUSG00000011008
AA Change: M17T

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mucolipins constitute a family of cation channel proteins with homology to the transient receptor potential superfamily. In mammals, the mucolipin family includes 3 members, MCOLN1 (MIM 605248), MCOLN2, and MCOLN3 (MIM 607400), that exhibit a common 6-membrane-spanning topology. Homologs of mammalian mucolipins exist in Drosophila and C. elegans. Mutations in the human MCOLN1 gene cause mucolipodosis IV (MIM 262650) (Karacsonyi et al., 2007 [PubMed 17662026]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced chemokine production in bone marrow-derived macrophages and impaired recruitment of peripheral macrophages in response to i.p. injections of LPS or live bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Mcoln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mcoln2 APN 3 146163527 splice site probably benign
IGL01370:Mcoln2 APN 3 146181830 missense possibly damaging 0.71
IGL01479:Mcoln2 APN 3 146175652 splice site probably benign
IGL02629:Mcoln2 APN 3 146170044 missense probably benign 0.28
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0109:Mcoln2 UTSW 3 146175718 missense probably damaging 1.00
R0458:Mcoln2 UTSW 3 146150013 unclassified probably benign
R1335:Mcoln2 UTSW 3 146180174 missense probably benign 0.00
R1440:Mcoln2 UTSW 3 146190382 nonsense probably null
R1452:Mcoln2 UTSW 3 146181814 missense possibly damaging 0.92
R1459:Mcoln2 UTSW 3 146192224 splice site probably null
R1510:Mcoln2 UTSW 3 146176610 missense probably benign 0.02
R1603:Mcoln2 UTSW 3 146180222 missense probably damaging 1.00
R1652:Mcoln2 UTSW 3 146163635 missense possibly damaging 0.48
R1718:Mcoln2 UTSW 3 146190474 splice site probably benign
R1826:Mcoln2 UTSW 3 146175472 missense possibly damaging 0.69
R4319:Mcoln2 UTSW 3 146150011 splice site probably null
R4719:Mcoln2 UTSW 3 146175713 missense probably benign 0.00
R4939:Mcoln2 UTSW 3 146192241 missense probably benign 0.07
R5475:Mcoln2 UTSW 3 146183786 missense probably damaging 1.00
R5718:Mcoln2 UTSW 3 146181826 missense probably damaging 1.00
R5906:Mcoln2 UTSW 3 146183741 missense probably damaging 1.00
R6911:Mcoln2 UTSW 3 146192256 missense probably damaging 1.00
R6963:Mcoln2 UTSW 3 146172035 missense probably damaging 1.00
R7142:Mcoln2 UTSW 3 146183569 critical splice donor site probably null
R7613:Mcoln2 UTSW 3 146175544 splice site probably null
R8076:Mcoln2 UTSW 3 146190414 missense probably damaging 1.00
R8271:Mcoln2 UTSW 3 146192424 missense unknown
Z1177:Mcoln2 UTSW 3 146175704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTATGGTGCTCAGCCTCA -3'
(R):5'- GACCAAAACAAACCAAGGTCTATTTT -3'

Sequencing Primer
(F):5'- TGCTCAGCCTCAGGGGTTC -3'
(R):5'- TCGTGCTCCAATCCATAC -3'
Posted On2020-06-30