Incidental Mutation 'R8077:Luzp1'
ID629068
Institutional Source Beutler Lab
Gene Symbol Luzp1
Ensembl Gene ENSMUSG00000001089
Gene Nameleucine zipper protein 1
SynonymsLuzp, 2700072H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136469761-136554780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 136543091 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 875 (V875G)
Ref Sequence ENSEMBL: ENSMUSP00000001116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001116] [ENSMUST00000063021] [ENSMUST00000105849] [ENSMUST00000129230] [ENSMUST00000168936] [ENSMUST00000170102]
Predicted Effect probably damaging
Transcript: ENSMUST00000001116
AA Change: V875G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001116
Gene: ENSMUSG00000001089
AA Change: V875G

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000063021
AA Change: V875G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060619
Gene: ENSMUSG00000001089
AA Change: V875G

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000105849
AA Change: V875G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101475
Gene: ENSMUSG00000001089
AA Change: V875G

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000129230
SMART Domains Protein: ENSMUSP00000128591
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
coiled coil region 11 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168936
Predicted Effect probably damaging
Transcript: ENSMUST00000170102
AA Change: V875G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130758
Gene: ENSMUSG00000001089
AA Change: V875G

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a leucine zipper motif. The exact function of the encoded protein is not known. In mice this gene affects neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Gene inactivation causes defective neural tube closure (exencephaly) and massive apoptosis in the hindbrain. Despite the incomplete penetrance of NTD, all homozygotes die perinatally due to complex cardiovascular anomalies. Other defects include an eyelid fusion defect, omphalocele and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Luzp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Luzp1 APN 4 136542776 missense probably damaging 1.00
IGL01766:Luzp1 APN 4 136542773 missense possibly damaging 0.92
IGL01868:Luzp1 APN 4 136542737 missense probably damaging 1.00
IGL03230:Luzp1 APN 4 136542878 missense probably benign 0.02
FR4548:Luzp1 UTSW 4 136543188 small insertion probably benign
FR4737:Luzp1 UTSW 4 136543196 small insertion probably benign
R0106:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R0674:Luzp1 UTSW 4 136543457 missense possibly damaging 0.85
R0676:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R1103:Luzp1 UTSW 4 136540730 missense possibly damaging 0.87
R1541:Luzp1 UTSW 4 136543325 missense probably damaging 1.00
R1812:Luzp1 UTSW 4 136542331 missense probably benign 0.03
R3924:Luzp1 UTSW 4 136542857 missense probably damaging 1.00
R4022:Luzp1 UTSW 4 136542193 missense probably benign 0.02
R4449:Luzp1 UTSW 4 136540863 missense probably damaging 1.00
R4976:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5119:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5411:Luzp1 UTSW 4 136543342 missense possibly damaging 0.59
R5659:Luzp1 UTSW 4 136542476 missense probably damaging 1.00
R5765:Luzp1 UTSW 4 136541029 missense probably damaging 0.98
R5828:Luzp1 UTSW 4 136540682 missense probably damaging 1.00
R6059:Luzp1 UTSW 4 136541480 missense probably benign 0.35
R6147:Luzp1 UTSW 4 136541063 missense probably damaging 1.00
R6181:Luzp1 UTSW 4 136543267 missense probably benign 0.01
R6200:Luzp1 UTSW 4 136541266 missense probably benign 0.12
R6368:Luzp1 UTSW 4 136541780 missense probably benign 0.24
R6581:Luzp1 UTSW 4 136540631 missense probably damaging 1.00
R6695:Luzp1 UTSW 4 136545298 missense possibly damaging 0.83
R6932:Luzp1 UTSW 4 136540813 nonsense probably null
R6998:Luzp1 UTSW 4 136543444 missense probably damaging 1.00
R7529:Luzp1 UTSW 4 136540932 missense probably damaging 1.00
R7878:Luzp1 UTSW 4 136541852 missense probably benign 0.00
R8154:Luzp1 UTSW 4 136541884 missense possibly damaging 0.47
R8292:Luzp1 UTSW 4 136542453 missense probably benign 0.01
RF028:Luzp1 UTSW 4 136543196 small insertion probably benign
RF033:Luzp1 UTSW 4 136543196 small insertion probably benign
RF040:Luzp1 UTSW 4 136543196 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGGGAGAGGCATACATC -3'
(R):5'- TGCGTATAGGCGTTAGTAGC -3'

Sequencing Primer
(F):5'- GGAGAGGCATACATCCACCAG -3'
(R):5'- ATAGGCGTTAGTAGCTTCCATGTTCC -3'
Posted On2020-06-30