Incidental Mutation 'R8077:Cln8'
ID629082
Institutional Source Beutler Lab
Gene Symbol Cln8
Ensembl Gene ENSMUSG00000026317
Gene Nameceroid-lipofuscinosis, neuronal 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location14881335-14901720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14894950 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 88 (D88V)
Ref Sequence ENSEMBL: ENSMUSP00000027554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027554] [ENSMUST00000123990] [ENSMUST00000128839] [ENSMUST00000132001] [ENSMUST00000133578]
Predicted Effect probably damaging
Transcript: ENSMUST00000027554
AA Change: D88V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027554
Gene: ENSMUSG00000026317
AA Change: D88V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TLC 62 262 3.4e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123990
AA Change: D88V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119031
Gene: ENSMUSG00000026317
AA Change: D88V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Blast:TLC 62 124 6e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128839
SMART Domains Protein: ENSMUSP00000121618
Gene: ENSMUSG00000026317

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132001
Predicted Effect probably benign
Transcript: ENSMUST00000133578
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with progressive epilepsy with mental retardation (EMPR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit late-onset progressive motor neuron degeneration and retinal photoreceptor degeneration. Mutants accumulate proteolipid in neuronal cytoplasm, have hindlimb weakness and ataxia, and die at 9-14 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Cln8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cln8 APN 8 14896637 missense probably benign 0.00
IGL00791:Cln8 APN 8 14894689 start codon destroyed probably null 0.99
IGL02340:Cln8 APN 8 14895178 missense probably damaging 1.00
IGL03037:Cln8 APN 8 14894679 utr 5 prime probably benign
IGL03213:Cln8 APN 8 14894845 missense probably damaging 1.00
R0544:Cln8 UTSW 8 14896769 missense probably benign 0.32
R4184:Cln8 UTSW 8 14895030 missense probably benign 0.01
R4634:Cln8 UTSW 8 14894842 missense probably damaging 1.00
R4925:Cln8 UTSW 8 14895004 missense possibly damaging 0.81
R5930:Cln8 UTSW 8 14896621 missense probably damaging 1.00
R6185:Cln8 UTSW 8 14896544 missense probably benign 0.02
R7567:Cln8 UTSW 8 14895057 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGATTCGGTCGACTCTAGCG -3'
(R):5'- AGCTCTGAGATTGATCGCTG -3'

Sequencing Primer
(F):5'- GTCGACTCTAGCGGTTGC -3'
(R):5'- TGAGATTGATCGCTGAACCC -3'
Posted On2020-06-30