Incidental Mutation 'R8077:Amotl1'
ID629088
Institutional Source Beutler Lab
Gene Symbol Amotl1
Ensembl Gene ENSMUSG00000013076
Gene Nameangiomotin-like 1
SynonymsJEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location14541966-14645056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14550502 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 805 (V805D)
Ref Sequence ENSEMBL: ENSMUSP00000013220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000223132]
Predicted Effect probably damaging
Transcript: ENSMUST00000013220
AA Change: V805D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076
AA Change: V805D

DomainStartEndE-ValueType
low complexity region 203 224 N/A INTRINSIC
low complexity region 418 441 N/A INTRINSIC
coiled coil region 449 472 N/A INTRINSIC
Blast:PAC 491 532 1e-10 BLAST
low complexity region 562 575 N/A INTRINSIC
Pfam:Angiomotin_C 616 822 4.4e-96 PFAM
low complexity region 853 878 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223132
AA Change: V842D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0971 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Amotl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Amotl1 APN 9 14571715 splice site probably benign
IGL02750:Amotl1 APN 9 14548791 missense probably benign 0.34
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0178:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0179:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0853:Amotl1 UTSW 9 14592778 missense probably damaging 0.99
R0941:Amotl1 UTSW 9 14596558 missense possibly damaging 0.90
R1447:Amotl1 UTSW 9 14555742 missense probably benign
R1689:Amotl1 UTSW 9 14593222 missense probably damaging 0.99
R1692:Amotl1 UTSW 9 14551722 missense possibly damaging 0.94
R1858:Amotl1 UTSW 9 14575401 missense probably benign 0.34
R2158:Amotl1 UTSW 9 14575169 missense probably benign 0.00
R2184:Amotl1 UTSW 9 14575390 missense probably benign 0.00
R3040:Amotl1 UTSW 9 14572773 missense probably benign 0.42
R4226:Amotl1 UTSW 9 14593678 missense probably benign 0.00
R4776:Amotl1 UTSW 9 14593373 nonsense probably null
R4854:Amotl1 UTSW 9 14593451 nonsense probably null
R5283:Amotl1 UTSW 9 14558484 missense probably damaging 1.00
R5478:Amotl1 UTSW 9 14592752 critical splice donor site probably null
R5562:Amotl1 UTSW 9 14575297 missense possibly damaging 0.56
R5970:Amotl1 UTSW 9 14596528 missense probably damaging 1.00
R6265:Amotl1 UTSW 9 14571655 missense possibly damaging 0.93
R6974:Amotl1 UTSW 9 14644920 nonsense probably null
R7016:Amotl1 UTSW 9 14593699 missense probably damaging 0.99
R7058:Amotl1 UTSW 9 14575236 missense possibly damaging 0.94
R7317:Amotl1 UTSW 9 14575219 missense probably benign 0.02
R7730:Amotl1 UTSW 9 14555763 missense possibly damaging 0.53
R7994:Amotl1 UTSW 9 14593361 missense probably damaging 0.98
R7996:Amotl1 UTSW 9 14593705 missense possibly damaging 0.94
R8116:Amotl1 UTSW 9 14555572 critical splice donor site probably null
R8140:Amotl1 UTSW 9 14572715 synonymous probably null
R8362:Amotl1 UTSW 9 14644922 missense probably benign 0.26
R8364:Amotl1 UTSW 9 14644922 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACCTCAGGGCTTCTATAGGTG -3'
(R):5'- CCCCAAATCTCAGATTCACTGTG -3'

Sequencing Primer
(F):5'- ATAGGTGCCGCTCTCTATATGC -3'
(R):5'- GATTCACTGTGAAAGTCCCTGAGAC -3'
Posted On2020-06-30