Mutagenetix > Incidental Mutation

Incidental Mutation 'R8077:Nipbl'

629106

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4933421G18Rik, 4921518A06Rik

MMRRC Submission

067511-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R8077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8320101-8473947 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8340734 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1995 (R1995S)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052965
AA Change: R1995S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: R1995S

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.5252

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 95.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,467,237 (GRCm39)	V132E	probably benign	Het
4930563M21Rik	C	T	9: 55,895,250 (GRCm39)	V315M	probably damaging	Het
Aadacl4fm1	T	C	4: 144,255,126 (GRCm39)	I182T	probably benign	Het
Alb	G	C	5: 90,615,214 (GRCm39)	R242P	probably damaging	Het
Amotl1	A	T	9: 14,461,798 (GRCm39)	V805D	probably damaging	Het
Arhgef3	T	C	14: 27,107,881 (GRCm39)	L179P	probably damaging	Het
Atp8b3	G	A	10: 80,366,858 (GRCm39)	L247F	possibly damaging	Het
Ccdc191	T	C	16: 43,735,968 (GRCm39)		probably null	Het
Celsr3	A	G	9: 108,705,530 (GRCm39)	H671R	probably benign	Het
Cemip	C	A	7: 83,652,616 (GRCm39)		probably benign	Het
Cfap97	G	T	8: 46,623,482 (GRCm39)	V291F	possibly damaging	Het
Clca3a2	A	G	3: 144,777,288 (GRCm39)	V861A	possibly damaging	Het
Cln8	A	T	8: 14,944,950 (GRCm39)	D88V	probably damaging	Het
Col18a1	C	A	10: 76,916,685 (GRCm39)	G330V	unknown	Het
Dis3	C	T	14: 99,327,471 (GRCm39)	R344Q	probably benign	Het
Esyt2	T	A	12: 116,305,848 (GRCm39)	S359R	possibly damaging	Het
Fbxo41	A	T	6: 85,450,211 (GRCm39)	L844Q	probably damaging	Het
Fn1	G	A	1: 71,651,761 (GRCm39)	T1372M	probably damaging	Het
Gbp5	G	A	3: 142,213,500 (GRCm39)	R472H	probably benign	Het
Gm4559	C	T	7: 141,827,553 (GRCm39)	R183K	unknown	Het
Gm9507	T	A	10: 77,647,604 (GRCm39)	E25V	unknown	Het
Golgb1	A	G	16: 36,738,995 (GRCm39)	I2486V	probably damaging	Het
Ifitm10	A	T	7: 141,924,704 (GRCm39)	V45D	probably damaging	Het
Ift80	A	G	3: 68,823,478 (GRCm39)	Y595H	probably benign	Het
Itga8	C	T	2: 12,247,244 (GRCm39)	V326I	probably benign	Het
Kif14	A	T	1: 136,399,186 (GRCm39)	H449L	possibly damaging	Het
Klrh1	A	G	6: 129,743,658 (GRCm39)	Y209H	probably benign	Het
Ldlrad1	G	A	4: 107,066,688 (GRCm39)	A8T	probably benign	Het
Lrrc8b	C	A	5: 105,627,883 (GRCm39)	S76R	possibly damaging	Het
Lrrn1	T	C	6: 107,545,783 (GRCm39)	L527P	probably damaging	Het
Luc7l	T	C	17: 26,474,047 (GRCm39)	V35A	probably damaging	Het
Luzp1	T	G	4: 136,270,402 (GRCm39)	V875G	probably damaging	Het
Mcf2l	G	T	8: 13,048,494 (GRCm39)		probably null	Het
Mcoln2	T	C	3: 145,896,169 (GRCm39)	M497T	probably damaging	Het
Mrgprb4	A	T	7: 47,848,203 (GRCm39)	S242T	probably benign	Het
Muc21	TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG	TCAGTGGTGGTCAGG	17: 35,930,628 (GRCm39)		probably benign	Het
Nup35	A	G	2: 80,469,280 (GRCm39)		probably null	Het
Or13a17	C	T	7: 140,271,046 (GRCm39)	S76F	probably benign	Het
Or2o1	A	G	11: 49,051,312 (GRCm39)	D157G	probably damaging	Het
Or6k2	A	G	1: 173,979,411 (GRCm39)		probably benign	Het
Prdm12	A	G	2: 31,532,316 (GRCm39)	K109E	probably damaging	Het
Ptch1	A	T	13: 63,688,626 (GRCm39)	L444Q	probably damaging	Het
Qtrt1	C	T	9: 21,331,392 (GRCm39)	R374*	probably null	Het
Rnase11	T	C	14: 51,287,398 (GRCm39)	D52G	probably damaging	Het
Rps6	A	G	4: 86,774,158 (GRCm39)	S148P	probably benign	Het
Rrm2b	T	C	15: 37,947,044 (GRCm39)	K86E	possibly damaging	Het
Sh2d1b2	A	G	1: 170,075,742 (GRCm39)	K59E	possibly damaging	Het
Six6	T	A	12: 72,987,100 (GRCm39)	W91R	probably damaging	Het
Slc23a2	C	A	2: 131,931,092 (GRCm39)	A136S	possibly damaging	Het
Slc9a5	G	A	8: 106,086,012 (GRCm39)	R593H	probably damaging	Het
Smbd1	T	C	16: 32,630,804 (GRCm39)	M1V	probably null	Het
Ssbp4	T	C	8: 71,051,647 (GRCm39)	Y239C	probably damaging	Het
Stox1	T	C	10: 62,501,345 (GRCm39)	E405G	probably damaging	Het
Tle7	C	T	8: 110,836,735 (GRCm39)	T207M	probably damaging	Het
Tmem192	A	G	8: 65,418,196 (GRCm39)	I194V	probably benign	Het
Tns3	A	T	11: 8,395,667 (GRCm39)	C1246S	probably damaging	Het
Ugt1a6a	A	T	1: 88,066,575 (GRCm39)	Q127L	probably benign	Het
Ush2a	A	G	1: 188,275,025 (GRCm39)	I1833V	probably benign	Het
Vmn2r66	A	T	7: 84,656,093 (GRCm39)	Y308N	probably benign	Het
Vti1a	T	G	19: 55,564,917 (GRCm39)	L191R	probably benign	Het
Zbtb38	A	T	9: 96,570,153 (GRCm39)	N310K	probably benign	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,396,157 (GRCm39)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,398,958 (GRCm39)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,326,353 (GRCm39)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,379,939 (GRCm39)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,379,981 (GRCm39)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,340,693 (GRCm39)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,380,023 (GRCm39)	missense	probably benign
IGL01723:Nipbl	APN	15	8,364,555 (GRCm39)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,391,305 (GRCm39)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,356,574 (GRCm39)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,388,558 (GRCm39)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,373,058 (GRCm39)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,353,131 (GRCm39)	splice site	probably null
IGL02547:Nipbl	APN	15	8,381,082 (GRCm39)	missense	probably benign
IGL02678:Nipbl	APN	15	8,380,594 (GRCm39)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,325,037 (GRCm39)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,379,798 (GRCm39)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,361,936 (GRCm39)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,368,463 (GRCm39)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,322,569 (GRCm39)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,380,360 (GRCm39)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8,391,221 (GRCm39)	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R0422:Nipbl	UTSW	15	8,381,112 (GRCm39)	missense	probably benign
R0486:Nipbl	UTSW	15	8,368,354 (GRCm39)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,332,964 (GRCm39)	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8,390,488 (GRCm39)	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8,322,562 (GRCm39)	splice site	probably null
R0726:Nipbl	UTSW	15	8,381,039 (GRCm39)	missense	probably benign
R0881:Nipbl	UTSW	15	8,337,096 (GRCm39)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,391,202 (GRCm39)	missense	probably benign
R0969:Nipbl	UTSW	15	8,321,712 (GRCm39)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,401,657 (GRCm39)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,379,773 (GRCm39)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,380,764 (GRCm39)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,396,148 (GRCm39)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,332,396 (GRCm39)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,368,035 (GRCm39)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,348,972 (GRCm39)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,373,001 (GRCm39)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,356,616 (GRCm39)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,379,771 (GRCm39)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,353,951 (GRCm39)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,340,691 (GRCm39)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,366,403 (GRCm39)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,322,702 (GRCm39)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,380,966 (GRCm39)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,364,490 (GRCm39)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,353,182 (GRCm39)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,340,723 (GRCm39)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,373,076 (GRCm39)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,325,145 (GRCm39)	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8,388,358 (GRCm39)	missense	probably benign
R3902:Nipbl	UTSW	15	8,379,730 (GRCm39)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,380,018 (GRCm39)	missense	probably benign
R4164:Nipbl	UTSW	15	8,368,418 (GRCm39)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,361,916 (GRCm39)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,388,690 (GRCm39)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,391,345 (GRCm39)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,368,208 (GRCm39)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,332,468 (GRCm39)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,395,313 (GRCm39)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,380,981 (GRCm39)	missense	probably benign
R5428:Nipbl	UTSW	15	8,359,780 (GRCm39)	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8,396,196 (GRCm39)	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5644:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5681:Nipbl	UTSW	15	8,330,866 (GRCm39)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,354,133 (GRCm39)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,364,328 (GRCm39)	splice site	probably null
R5970:Nipbl	UTSW	15	8,326,302 (GRCm39)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,353,748 (GRCm39)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,325,052 (GRCm39)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,364,390 (GRCm39)	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8,347,867 (GRCm39)	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8,354,064 (GRCm39)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,381,049 (GRCm39)	missense	probably benign
R6707:Nipbl	UTSW	15	8,354,043 (GRCm39)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,352,074 (GRCm39)	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8,332,969 (GRCm39)	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8,321,619 (GRCm39)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,373,090 (GRCm39)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,359,779 (GRCm39)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,325,120 (GRCm39)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,372,977 (GRCm39)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,335,356 (GRCm39)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,322,585 (GRCm39)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,381,010 (GRCm39)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,388,186 (GRCm39)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,326,333 (GRCm39)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,320,971 (GRCm39)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,355,236 (GRCm39)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,340,742 (GRCm39)	missense	possibly damaging	0.91
R8119:Nipbl	UTSW	15	8,388,696 (GRCm39)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,368,225 (GRCm39)	missense	probably benign
R8739:Nipbl	UTSW	15	8,332,904 (GRCm39)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,330,210 (GRCm39)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,391,271 (GRCm39)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,381,104 (GRCm39)	missense	probably benign
R8991:Nipbl	UTSW	15	8,320,997 (GRCm39)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,356,608 (GRCm39)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,368,215 (GRCm39)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,380,340 (GRCm39)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,366,373 (GRCm39)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,321,032 (GRCm39)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,388,418 (GRCm39)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,381,199 (GRCm39)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,353,021 (GRCm39)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,337,366 (GRCm39)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,368,183 (GRCm39)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,368,164 (GRCm39)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,366,436 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGTTGCATGCAAGAAAAG -3'
(R):5'- AATACCTCCTAAGTAGCTTCCTTTG -3'

Sequencing Primer
(F):5'- CCAATGTCTACAGAGTGAGGTCC -3'
(R):5'- GGAGTATTGATCCTAATTCTCTTT -3'

Posted On

2020-06-30