Incidental Mutation 'R8077:Rrm2b'
ID629107
Institutional Source Beutler Lab
Gene Symbol Rrm2b
Ensembl Gene ENSMUSG00000022292
Gene Nameribonucleotide reductase M2 B (TP53 inducible)
Synonymsp53R2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location37923952-37961318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37946800 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 86 (K86E)
Ref Sequence ENSEMBL: ENSMUSP00000022901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022901] [ENSMUST00000137636] [ENSMUST00000144498] [ENSMUST00000145155] [ENSMUST00000145175] [ENSMUST00000146821] [ENSMUST00000153481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022901
AA Change: K86E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022901
Gene: ENSMUSG00000022292
AA Change: K86E

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 41 308 4.2e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137636
AA Change: K34E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119400
Gene: ENSMUSG00000022292
AA Change: K34E

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 6 261 1.7e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144498
AA Change: K86E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121069
Gene: ENSMUSG00000022292
AA Change: K86E

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 32 111 2.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145155
AA Change: K32E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000145175
AA Change: K72E

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114343
Gene: ENSMUSG00000022292
AA Change: K72E

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 18 99 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146821
SMART Domains Protein: ENSMUSP00000123691
Gene: ENSMUSG00000022292

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 13 101 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153481
Meta Mutation Damage Score 0.8327 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Loss of both functional copies of this gene results in growth retardation, multiple organ failure, and ultimately premature death due to kidney failure. Spontaneous mutation rates and apoptosis are increased in the kidneys due to an attenuation of dNTP pools and a resulting impairment of DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Rrm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Rrm2b APN 15 37929075 missense probably damaging 1.00
IGL00806:Rrm2b APN 15 37931622 missense probably benign 0.02
IGL01145:Rrm2b APN 15 37944560 missense probably damaging 0.96
norfolk UTSW 15 37937351 critical splice acceptor site probably null
PIT4515001:Rrm2b UTSW 15 37946804 missense probably benign
R0026:Rrm2b UTSW 15 37953741 missense probably benign 0.19
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0624:Rrm2b UTSW 15 37931645 missense probably benign 0.00
R1371:Rrm2b UTSW 15 37946809 missense probably benign 0.06
R1635:Rrm2b UTSW 15 37945084 missense probably damaging 1.00
R1692:Rrm2b UTSW 15 37927322 nonsense probably null
R1710:Rrm2b UTSW 15 37929096 missense probably damaging 1.00
R2273:Rrm2b UTSW 15 37945051 missense possibly damaging 0.92
R3196:Rrm2b UTSW 15 37945147 splice site probably null
R4459:Rrm2b UTSW 15 37945153 splice site probably null
R5310:Rrm2b UTSW 15 37927327 missense probably damaging 1.00
R5747:Rrm2b UTSW 15 37927390 missense probably benign
R7343:Rrm2b UTSW 15 37944573 missense probably benign 0.18
R7378:Rrm2b UTSW 15 37931647 missense probably benign
R7539:Rrm2b UTSW 15 37937351 critical splice acceptor site probably null
R7797:Rrm2b UTSW 15 37927261 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTACTCCATCACTGGGAGAC -3'
(R):5'- CACTTCCTTGAACATGCCAGG -3'

Sequencing Primer
(F):5'- GAGACTTTCTTTCCTCAGGCAGG -3'
(R):5'- CTGGGATTTGAACTCAGGACC -3'
Posted On2020-06-30